Expression Of Plasma MicroRNA-126 In Patients With Hypertensive Disorder Complicating Pregnancy And Its Clinical Significance

Hypertensive disorder complicating pregnancy?HDCP?is an unexplained endemic diseasea in women during pregnancy,the incidence rate of accounts for about 6%-8%of all pregnancies,HDCP is the second leading cause of maternal mortality,maternal deaths caused by about 10%¹6%of the total number of pregnancy-related deaths,serious impact on pregnant women,postpartum women,and infant life and health.The disease occurred after 20weeksofpregnancy,systolicbloodpressure?SBP??140mmHg?1mmHg=0.133kPa?and/or diastolic blood pressure?DBP??90mmHg,with or without proteinuria?proteinuria>300mg/24h urine?and multiple organ damage and systemic,there may be severe convulsions,coma,cerebral hemorrhage,heart failure,placental abruption and even death.At home and abroad,according to the basic pathogenesis and organ damage degree of hypertensive disorders in pregnancy are divided into five categories,respectively,gestational hypertension,mild preeclampsia,severe preeclampsia,pregnancy with chronic hypertension,chronic hypertension complicated with preeclampsia.In recent years,Non-invasive prenatal diagnosis technology is developing rapidly,with the application of new technology,especially the development of molecular biology and medical genetics,prenatal diagnosis technology continuously toward the direction of the early,rapid and accurate,noninvasive direction,more and more diseases have been able to in the embryonic development of relatively early,safe and accurate diagnosis,more and more scholars to research focus shifted to early non-invasive prenatal diagnosis of HDCP,combined with molecular biology techniques for specific molecules related to early HDCP is inevitable trend.Some of the early research suggests Adrenomedullin,pregnancy associated plasma protein A?PAPP-A?,placental protein 13?PP-13?and other biomarkers can predict women during pregnancy can develop hypertensive disorder complicating pregnancy.However,these biomarkers of prediction specificity and sensitivity is not high,the misdiagnosis rate and the missed diagnosis rate make it difficult to use in clinical routine examination,lead to HDCP is lack of positive and effective prevention and control measures.Hypertensive disorder complicating pregnancy caused by maternal and perinatal son of high mortality and complications have been threatening the modern maternal and child health,looking for a new type of biomarkers to predict the occurrence of HDCP is clinical practice is an urgent need to solve the problems in the work.Studies have shown that the pathogenesis of preeclampsia recognized by abnormal placental vasculature system and endothelial cell dysfunction leads to placental ischemia.Endothelial progenitor cells?EPCs?dysfunction is the basis of preeclampsia endothelial cell loss,the high expression of microRNA-126 in endothelial cells,can promote blood vessels of freshman,to maintaining the integrity of the steady state and vascular endothelial cells play an important role.microRNA-126 can enhance the EPCs proliferation,differentiation and migration,microRNA-126 is an angiogenesis related microRNA,has been confirmed in endothelial cells cultured in vitro and in vivo ischemia induced angiogenesis,microRNA-126 is an potential role in angiogenesis.MicroRNA-126 is essential for the promotion of angiogenesis and the mechanism of placental blood perfusion in preeclampsia.The purpose of this study was to investigate the expression and clinical significance of plasma microRNA-126 in pregnant women with hypertensive disorder complicating pregnancy and healthy pregnant women.Objective:To study the micro RNA-126 expression level by detecting the HDCP patients'plasma,comparison between groups in terms of hypertensive disorder complicating pregnancy,between hypertensive disorder complicating pregnancy expression differences and control group with normal pregnancy,To investigate hypertensive disorder complicating pregnancy and healthy pregnancy patients plasma microRNA-126 expression changes and its clinical significance.Materials and methods1.Clinical dataRecruited 75 patients in our maternity hospital from November 2015 to July 2016,and divided into the following five groups:?1?pregnant women with gestational hypertension group?n=15;after 20 weeks of gestation blood pressure?140mmHg/90mmHg?;?2?pregnant women with mild preeclampsia group?n=15;after 20 weeks of gestation blood pressure?140mmHg/90mmHg with proteinuria?0.3g/24h or random urine protein+?;?3?pregnant women with severe preeclampsia group?n=15;after 20 weeks of gestation blood pressure?160mmHg/90mmHg with proteinuria?2.0g/24h or random urine protein++?;?4?pregnant women with healthy early pregnancy group?n=15?;?5?pregnant women with healthy late pregnancy group?n=15?.The collected cases for the first pregnancy,clinical diagnostic conforms to the eighth edition of gynecology and obstetrics teaching material standards.Blood pressure and urine protein levels were also examined.2.Exclusion standardpatients who no other obstetric complications and complications;no recent medical history;no blood system,tumor and autoimmune diseases.3.Method HDCP patients were divided into gestational hypertension group?A?,mild preeclampsia group?B?,severe preeclampsia group?C?,health pregnancy patients were divided into healthy early pregnancy group?NGT1?,healthy late pregnancy group?NGT2?,using RT-PCR to detect plasma microRNA-126 expression quantity,and analysis Hypertensive disorder complicating pregnancy the relationship with age,gestational age,SBP,DBP,urinary protein.3.1 Plasma separation and storage After admission to hospital,venous blood?5ml?was extracted at early in limosis condition and was injected into EDTA tubes,blood sample were then centrifuged 3000r/min,10minutes,within 1hour and Store tubes temperature 4°C,the plasma will be transferred to the new EP,the extracted blood sample also were centrifuged 16000xg/min,10minutes,within 1 hour and Store tubes temperature 4°C,and transfer the new EP tube,if the same day nucleic acid purification,can stored in 2-8°C,if long time storage,keep the plasma frozen in-80°C.3.2 Extraction of total plasma RNAunified by QIAGEN company mi RNeasy Serum/Plasma Kit total RNA extraction Kit,using UV spectrophotometric determination of total RNA content and purity.3.3 Primer design according to the relevant sequence in GeneBank database design microRNA-126 primers,U6 as the reference gene,the primer sequence is as follows:microRNA-126 RT Primer:ACACTCCAGCTGGGTCGTACCGTGAGTAATAA Forward Primer:TCGTACCGTGAGTAATAATGCG Reverse Primer:CGCATTATTACTCACGGTACU6 Forward Primer:CTCGCTTCGGCAGCACA Reverse Primer:AACGCTTCACGAATTTGCGT3.4 Detection of microRNA-126 expressionby stem loop retrovirus fluorescence quantitative polymerase chain reaction?PCR?,using U6 as internal control.?1?reverse transcription reaction,using reverse transcription kits?TAKARA Mir-X?micrornas First-Strand short?in a thermal cycler system for ordinary PCR?Eppendorf company,Germany?are mixed into 50uL reaction system,,reaction conditions:37°C,30min;75°C,5min;Reverse transcription product?cDNA?RT-PCR test immediately.?2?RT-PCR detection using RT-PCR Kit?TAKARA SYBR?Premix Ex TaqTM II Tli RNaseH Plus?in RT-PCR instrument?Thermo company,USA?each cDNA sample test three times at the same time,the cycle threshold?Ct value?of 3 times the average,with 20uL reaction system,PCR reaction parameters:95°C,30s,Circulation 40,95°C,5s;60°C,34s fluorescence detection.4.Statistical methodAll date was analysis with SPSS 20.0 software.Measurement data was expressed by?meanSD?,adopting single factor variance analysis?One-way ANOVA?were compared among multiple groups,multiple comparison between groups using LSD method;analysis real time-qPCR results,with U6 as the reference gene,using 2^-??Ctmethod to calculate the relative gene expression,using multiple linear regression analysis the influence factors of microRNA-126 expression,P<0.05 was regarded as indicate statistical significance.Results1.Basic clinical data comparisonNo statistically significant difference between the five groups in age and The gender of a fetus was born?P>0.05?.For health group in early pregnancy to collect specimens for 13 weeks of pregnancy,gestational age and other groups have no comparability;Severe preeclampsia group of systolic blood pressure were higher than gestational hypertension,mildpreeclampsia,healthypregnancyearlyandlate group,healthy pregnancy early and late group of systolic blood pressure were lower than healthy gestational hypertension,mild preeclampsia group,there were statistical significance difference?P<0.05?;Severe preeclampsia group of diastolic blood pressure were higher than healthy pregnancy early and late group,that were lower than gestational hypertension,mild preeclampsia group,difference has statistical significance?P<0.05?;Severe preeclampsia group of 24 hours urinary protein were higher than gestational hypertension,mild preeclampsia group,healthy pregnancy early and late group,and the difference was statistically significant?P<0.05?;2.Comparison the microRNA-126 expression level between groups in terms of hypertensive disorder complicating pregnancy,between hypertensive disorder complicating pregnancy group and control group with normal pregnancyCompared with healthy pregnancy early group,Severe preeclampsia group and healthy pregnancy late group plasma microRNA-126was decreased,there was significant difference?P<0.05?;Compared with healthy pregnancy late group,gestational hypertension and mild preeclampsia group plasma microRNA-126 was increased,there was significant difference?P<0.05?;Compared with mild preeclampsia group,severe preeclampsia group patients plasma microRNA-126 expression decreased,there was statistically significant?P<0.05?;Gestational hypertension patients plasma microRNA-126relative expression for mild preeclampsia,severe preeclampsia group,health group in early pregnancy,late pregnancy group were 0.59,2.35,0.40,3.05times;Mild preeclampsia patients plasma microRNA-126 relative expression for severe preeclampsia group,the health group in early pregnancy,late pregnancy group were 3.94,0.67,5.13 times;Severe preeclampsia patients plasma micro RNA-126 relative expression for health group in early pregnancy,late pregnancy group were 0.17,1.30 times;3.Multiple linear regression analysis Age,pregnant weeks,SBP,DBP,urinary protein were the influence factors of Hypertensive disorder complicating pregnancy.influence from big to small for gestational age,24 hours urinary protein in turn,systolic blood pressure?SBP?,age,diastolic blood pressure?DBP?.4.Conclusionmicro RNA-126 disease plasma expression in the gestational hypertension patients,and in the disease with severe preeclampsia group patients plasma microRNA-126 expression was lowest,that prompt the plasma microRNA-126expression may participate in the occurrence and development of gestational hypertension disease process.Multiple linear regression analysis Age,pregnant weeks,SBP,DBP,urinary protein were the influence factors of Hypertensive disorder complicating pregnancy.influence from big to small for gestational age,24 hours urinary protein in turn,systolic blood pressure?SBP?,age,diastolic blood pressure?DBP?.