CD44, V6, V7 Expression In Epithelial Ovarian Carcinoma And Its Significance

PrefaceOvarian cancer is one of the most complicated gynecologic malignant tumors and is diagnosed at advanced stages in approximately 75% of patients. Most of them present with abdominal diseases in the form of tumor implants that attached to the peritoneal mesothelial surface that are difficult to completely eradicate with surgery alone. Post - operative chemotherapy has less effect because of drug resistance. The high mortality and re - occurrence rate hasn 1 altered for many years. It has been paid lots of attention on early diagnosis of cancer, assessment of status and evaluation of metastatic potential and prognosis.The main metastastazition way of ovarian cancer is that tumor cells shed from primary ovarian mass into the peritoneal cavity, followed by attachment of cells onto the mesothelial surfaces. There are a lot of molecules on cell surface or in matrix involved in it such as cad-herin, integrin , and CD44. The adhesion molecules CD44 is a trans-membranal surface glycoprotein which may bind to hyaluronic acid in pericellular matrix and play an important role in cell - cell and cell -matrix interactions, activating T - lymphocyte , inducing lymphocyte home , promoting the release of cell factors and the blood vessel formation. In man the gene is located in chromosome 11p13, which is made up of 20 highly reserving exons separated by irregular introns . Twelve exons of it can generate many variant isoforms by splicing. Tumor samples show a more complicated patterns of CD44 expression, indi-eating a loss of splice control in malignantly transformed cell. In color-ectal cancer, breast and cervical cancer as well as gastric cancer, correlation between the over - expression of specific isoforms of CD44 and poor prognosis was reported. We used semi - quantitatively reverse transcription polymerse Chain Reaction { RT - PCR) to detect the mRNA of CD44v6, v7 in benign premalignant and malignant epithelial neoplasms and to discuss the significance.Material1. Subjects: the fresh tissues of 93 cases; 38 epithelial ovarian cancer, 15 borderline tumor, 30 benign tumor and 10 normal ovarian tissues were collected and stored at 70 C after surgery from Aug. 2000 to Oct. 2001. cDNA cycle kit was provided by TAKARA company.2. Instruments: Gene Amp PCR system et al.3. Agent: cDNA cycle kit, primers of exon 6, exon 7 and -ac-tin.Methods1. Total cellular UNA was extracted by the acid guanidinium -phenol - chlorform method, and mRNA was purified using OligotexdT.2. cDNA was synthesized with reverse transcriptase followed by amplification PCR with cDNA cycle kit.3. The conditions of PCR were as follows: 30 (v7) or 32 (v6) cycles of 94 for 30 seconds and 55 for 1 minute and 72 for 90 seconds. The primers used were;P1 5'- AGCCCAGAGGACAGTGCCGG - 3' P2 5'- ATGGGACGAGGTCATCAAGCAGGA - 3' P3 5'- TCCAGGCAACTCCTGTTGTCGAA - 3' P4 5' - ACAGAGTACTTGCGCTCAGGGAG - 3' 10 l of 50 l PCR reaction mixture were electrophoresed in 2% agarose gel. The relative content was analyzed by gel image analyzing system.4. Statistical analysis: All data are presented as medians with ranges. Continuous data were compared with student t test using Microsoft Excel..Result1. The expression of exon 6 and exon 7 didnt appear in normal o-varian tissue.2. CD44 v7 has paint staining in one sample of ovarian cancer.3. The expression rate and relative content of exon 6 in epithelial ovarian cancer, borderline tumor and benign tumor respectively were 97.37% and 110.44, 73.77% and 102.30, 20.00% and 99.56.4. The relative content of ovarian cancer in advanced stage and early stage were statistical different. So does having lympha node metastasis and having not.DiscussionThe surface glycoprotein CD44 is widely distributed in different tissues. The functions are that; 1. Lymphocyte homing and activating 2. Lympha circulation 3. Promotion of tumor cell% metastasis by adhe-ring, filtrating and signal transferring. It has been demonstrated that CD44 expression is higher in malignant tumor cell than i...