The Species Dentification Method And Preliminary Study On Gynogenesis Of Paramisgurnus Dabryanus And Misgurnus Anguillicaudatus

Paramisgurnus dabryanus(Cobitidae; Cobitinae; Paramisgurnus) and Misgurnus anguillicaudatus(Cobitidae; Cobitinae; Migurnus) are loaches with high morphological similarity.They are widely distributed in freshwater and becoming two important economical fish species of freshwater aquaculture in China. The two species are believed to increase feelings of invigoration when consumed, resulting in huge demand and an annual increase in market prices. However, the two loaches and their hybrids look extremely similar and are difficult to distinguish visually for resolving the problem of mixing and export quarantine. Female loaches usually grow faster than males; the development of all-female loaches in aquaculture would increase production and bring more profits to farmers. The mechanism of sex determination in large-scale loach also is cryptic. It’s necessary to understand the mechanism of sex determination and provide the data for selecting all-female progeny and fine breeding in both loaches by inducing gynogenesis.Samples of P. dabryanus and M. anguillicaudatus from different geographical locations were collected and applied in this study. We established a method with mitochondrial DNA polymorphisms marker and microsatellite markers amplification to identify two kinds of fish and their hybrids fast. Gynogenesis was induced using heterologous sperms in both loaches.The sexes of the gynogenetic progenies were also identified.The results are as follows:A gap were determined, as a consequence, P. dabryanus was 71 bp less than M. anguillicaudatus in COXⅡ-t RNALys region.A species-specific primer pair M/P(F: CCGCCCAGGAGTATTTTATG;R: TGGCATTTCATCAGGGGTG)was designed. The results of electrophoresis revealed specific-specific sizes(214 bp for P. dabryanus and 285 bp for M. anguillicaudatus). In conclusion, the new primers provide fast, reliable, and accurate identification between P. dabryanus and M. anguillicaudatus based on mitochondrial DNA difference in length.P.dabryanus microsatellite markers and M. anguillicaudatus microsatellite markers were randomly selected and used for cross-species amplification.The markers Pda71 from P.dabryanus and Mac287、Mac375 from M. anguillicaudatus are species-specific. The successful amplification results indicated that three pairs of primers could distinguish both loaches. More samples from the progenies each of reciprocal crosses were effectively amplificated with the primers selected above. The way to identify the hybrids is feasible by analyzing target bands that have been detected or not. The female parent of hybrid could be determined according to the primer pair M/P amplification which had distinct, specific-specific band sizes. Three microsatellite loci selected here would be the tools for identifying wild hybrids to invest on the situation of rare hybridization between the two loach species in nature.Gynogenesis was successfully induced in both loaches by cold shock in the present study. Gynogenetic progenies(35 individuals) were all-female by observation of histological sections. The sex determination in M. anguillicaudatus was determined by the putative XX/XY system. The results were consistent with previous reports. The sex ratio of the progenies(47 individuals) in gynogenetic families of P. dabryanus was significantly deviated from 1:1 expectation with a female bias of 93.62%. The data of sex ratio indicated that the sex determination system in P. dabryanus would also be XX/XY.The major achievement of these studies were that mt DNA markers was developed for the first time, the complete identification method to distinguish the two kinds of loach and hybrid was created by combining the technology of microsatellite loci primer cross-species amplification. Gynogenesis was successfully induced in both loaches by cold shock. By inducing gynogenesis and scoring sex ratios of the progenies, M. anguillicaudatus was determined to exhibit XX/XY sex determination,and for the P. dabryanus. However,further studies are needed to provide more genetic information to better understand the mechanism of sex determination in P. dabryanus.