| ObjectiveHuman cytomegalovirus ( HCMV) is the most common pathogen in congenital malformation due to intrauterine infection. HCMV infection can result in a wide variety of clinical manifestations, but the mechanisms remain unclear yet. Host factors such as celluar or humoral immune response might play an important role. On the other hand, genetic variability among different virus strains could influence clinical manifestations of HCMV infections. Recent data suggested that HCMV UL/b'region display considerable genetic polymorphisms in low passage clinical isolates and laboratory strains. The purpose of our study is to investigate UL136 gene polymorphism in low passage clinical isolates and try to find the relationship between the polymorphism and the outcome of congenital CMV infection. We hope our report could establish molecular basis for revealing the function of UL136 protein and pathogenesis of congenital CMV infection.Materials and methods1 subject materials48 low passage clinical strains were isolated from infants treated in our hospital between 1988 and 1993. They ranged in age from 0 to 14 months old. There are 28 strains isolated from patients with Jaundice , 11 strains from Microcephalus and 9 strains from Megacolon. The specimens were obtained through HCMV isolation experiment and stored at -70℃. Strains were passaged less than 10 times. In 2000, these isolates were proven containing detectable HCMV - DNA by u-sing FQ - PCR. 2N Methods1) Sample preparationThe supernatant of cultures were digested with identical volume lysis buffer at 100℃ for 15 min. DNA was isolated for use as template.2) Primer designAccording to Toledo sequence, the primers for complete coding region and for identification were designed by using software primer premier 5. 0.Primers for complete coding region;Upper primer UL136ca:5' TCGGACATCGAGGAACTCTTG 3' Lower primer UL136cb:5' GTGCCAGTGGTAAGCCAGATA 3' Primers for identification:Upper primer UL136U1:5' GAATGTCGGCTACGGGTGT 3' Lower primer UL136D1:5' TGTCTCGCCAACTGTCCTG 3' Lower primer UL137D1:5' TCACGCCGATGATGGGTA 3' UL136ca/cb were designed to amplify a full length of UL136 ORF,while UL136U1/D1 were designed to be homologous to the internal region of ORF. These primers were also used for nucleotide sequencing of UL136 gene.3) PCR amplification of UL136 geneThe amplification conditions were 951 for 4 min,followed by 35 cycles of 961 for 45 sec,551 for Imin, and 72℃ for Imin 30sec, and a final extension at 72℃ for 10 min. PCR products were detected on a 1.5% agerose gel, stained by ethidium bromide. The bands containing the amplified fragments were visualized under UV illumination.4)Fragement recovery of PCR productsPCR products were separated on a 1. 5% agarose gel. The expected fragment was recovered by using PCR Fragment Recovery Kit according to the manufacturers instructions.5 ) DNA sequencing6) Sequence data analysisSequence analysis was performed by using programmes DNA-club, Bioedit, GeneDoc, DNAsis and DNAstar.7) Sequence submissionUL136 open reading frames of 18 HCMV clinical isolates were submitted to GenBank by using program Sequin.Results1 PCR amplification result18 among 48 isolates were amplified successfully and positive rate was 37.5%. Among them, there were 12 Jaundice strains, 4 Micro-cephalus strains and 2 Megacolon strains.2 The polymorphism of UL136 gene DNA and amino acid sequence1) The length of UL136 ORF in all 18 clinical isolates was similar to that of Toledo, 723 bp in size. They hade the potential to encode 241 amino acid protein.2) DNA sequence variations were all nucleotide substitutions and neither insertions nor deletions were detected.3 ) Alignment comparison revealed that UL136 sequences of various clinical isolates contained 97. 7% -99. 3% of nucleoptide (nt) and 96.6% -99. 1% of amino acid (aa) sequence homologies compared with those of Toledo, respectively. Amino acid variability rate of UL136 protein was 0.83% - 3.3%.4) Most of amino aci... |
PDF Full Text Request