Font Size: a A A

The Research Of Pathogenesis By Microarray In Oral Lichen Planus

Posted on:2011-08-16Degree:MasterType:Thesis
Country:ChinaCandidate:F Y YangFull Text:PDF
GTID:2154360308974531Subject:Oral and clinical medicine
Abstract/Summary:
Objective:Oral Lichen Planus(OLP) is one most non-infectious common diseases mucous membrane of mouth ,not easy to cure,there is a certain tendency to cancer.This disease predilection in the middle-aged,more common in woman over 40 years of age,the symptom increased with age. The disease of unknown etiology and pathogenesis of complex.In recent years, the reported cases of oral lichen planus cancerous upward trend, therefore, the pathogenesis of oral lichen planus oral medical research studies to become hot spots. Gene chip technology is currently the international community will soon rise and rapid development of a biotechnology, life sciences, it is playing an increasingly important role. Gene chip technology is currently the most advanced genetic research, the most effective methods, with the development of biological technology, gene chip technology becomes more widely used in pathogenesis studies, to discover differentially expressed genes. In this study, cDNA microarray screening of oral lichen planus and normal oral mucosa of differentially expressed genes and their signal transduction pathways, analysis of oral Lichen Planus of the differentially expressed genes and signal transduction pathways, and then shudied the pathogenesis of oral lichen planusMethod:1 Sample collectionAll Samples were collected from May to November in 2008 in the fourth Hospital of Hebei Medical University, the clinical diagnosis of dental patients with oral lichen planus, and after informed consent to take a small amount of pathological lesions were cut when the mucosa ( histopathological diagnosis of oral lichen planus to reservations). Specimen was loaded in the frozen pipes which were sterile DEPC treated and then stored in liquid nitrogen tanks in transit to save the low-temperature refrigerator within 10 min after excision. The control normal tissues derived from the Fourth Hospital of Hebei Medical University, dental sterile conditions, healthy pulling wisdom teeth removed when the gingival or oral mucosa plasty in the removal of oral mucosa .the preservation method is identical with OLP tissue2 ChipsThe high-density arrays containing 32 050 genes in the genome were supplied by Shanghai Kangchen Technology Limited (phalanx Taiwan).To taked the appropriate amount tissue (50 ~ 100 mg) of the OLP tissue samples and normal tissues saved correctly,, using the BioPulverize frozen crushed organizations respectively, plus 1ml of RNA extraction reagent Trizol (Invitrogen), using the Mini-Bead-Beater-16 after the extraction of homogenized RNA. Determination of RNA using the Nanodrop spectrophotometer 230 nm, 260 nm and 280 nm absorption values to calculate the concentration and to assess the purity. Electrophoresis reagents with formaldehyde denaturing agarose gel electrophoresis to detect RNA purity and integrity. To obtain RNA QC report. The detection of high-quality RNA samples, complete, no RNase contamination, there is no DNA contamination, continue the experiment. RNA samples were reverse transcription reaction synthesis cDNA, cDNA second strand synthesis, aRNA synthesis and purification, fluorescent labeling and purification of aRNA. Nanodrop test the efficiency of the use of fluorescent marker, marking the efficiency of compliance in order to ensure the reliability of experimental results the follow-up chips. The use of Ambion RNA Fragmentation Reagents marked with a good aRNA for fragment processing. Under standard conditions will mark a good probe and high-density genomic hybridization chip.3 Chip scanning and image analysisScaned the chip fluorescence intensity using the GenePix 4000B scanner and converted the results into numeric data retention, to analyze the raw data calculations using of software packages (Genepix Pro V6.0 and Genesring) and filt out the differentially expressed genes of two groups between the sample and channels by FoldChang and T-test method of screening, to express the difference between two times the positive, to have statistical significance.4 RT-PCR verified the reliability of the resultsIn order to exclude errors and false positive results in gene selection in this experiment,we validated the results of some of the experimental samples part of the gene using RT-PCR validation.7 cases were randomly selected experimental samples (3 normal and 4 cases of OLP) and randomly selected three upregulated genes (PHF19, DBH, CD72) for RT-PCR validation, in order to correct this difference, the synthesis of RNA reverse transcription cDNA. PCR amplification. Primer sequence: GAPDH:antisense :5'GGGAAACTGTGGCGTGAT3',Justice:5'GAGTGGGTGTCGCTGTTGA3', fragment length 299 bp. PHF19:: anti-sense F: 5'CGGGAAGATCAAGA GGGTCA3',Justice:R:5'ATGCAGCGTCGGCAGAAC3', fragment length 276 bp. DBH: antisense F: 5'TGGTGATAGAAGGACGAAACG3', Justice:R:5'GCAGTAGCCAGTG AGGATGAA3', fragment length of 158bp. CD72: antisense F: 5'CCAAATGGTGGTTCAGGGA3',Justice:R:5'GGCA CAGGTTCTTGTTGGC3', fragment length of 265bp. PCR reaction conditions: 95℃denaturation 3min, 40 Ge PCR cycles (94℃, 20s; 59℃, 20s; 72℃, 30s); 72℃extension of 5 min. PCR reaction also amplified GAPDH as an internal reference, the annealing temperature and cycle times according to different primers and templates to adjust PCR product with 100 bp DNA Ladder 2% agarose gel electrophoresis, ethidium bromide staining to detect whether the PCR product a single specific amplification bands and make grayscale imaging scans. RT-PCR validation results from the Rotor-Gene Real-Time Analysis Software 6.0 (Build 14) software processing.5 Statistical MethodsUsing Spss 13.0 statistical software for statistical processing, the experimental data comparison between each group using one-sample mean comparison T test analysis to P <0.05 for the difference statistically significant.Results: 1 There were 142genes exhibited significant changes in expression levels in the OLP in comparison with normal tissues. 25 genes were overexp ressed more than doubled and 117 genes were under 2 expressed to below of the control level.The differentially expressed genes have different functions,the biological process functions are cellular process,physiological process,regulation of biological process and development;the cellular component functions are cell,organell,extracellular region,protein complex and extracellular matrix;the molecular functions are binding,catalytic activity,single transducer activity and transpoter activity.2 There were 8 pathways different in the expression,they were Epithelial cell signaling in Helicobacter pylori infection-Homo sapiens (human),Cysteine metabolism-Homo sapiens (human),ECM-receptor interaction-Homo sapiens(human),Pyruvate metabolism-Homo sapiens (human),Beta Oxidation of Unsaturated Fatty AcidsDrug metabolism -cytochrome P450-Homo sapiens (human) , Tyrosine metabolism - Homo sapiens (human) and Glycosaminoglycan egradation - Homo sapiens (human). The Epithelial cell signaling in Helicobacter pylori infection pathway is closely related to infection diseases and take part in OLP. The gene GIT1 and CCL5 play a momentous part in OLP .Conclusion:1The differentially expressed genes and signal transduction pathways can be selected by microarray2 There are multiple differeeeence in the expression of different genes,is a multi-gene changes in cascade in OLP occurrence and development.3 Differentially expressed genes and pathways with different functions were revealed in OLP, which may play some roles in the progression of OLP.
Keywords/Search Tags:oral lichen planus(OLP), diffentially expressed gene, diffentially expressed pathway, Epithelial cell signaling in Helicobacter pylori infection, microarray
Related items