| Objective: To investigate whether the intercellular adhesion molecule-1(ICAM-1) gene polymorphisms(G241R and K469E) correlates with colorectal cancer(CRC) in population of North China, and to provide valuable reference for risk of CRC.Methods:1 Specimens1.1 Blood specimens: 87 cases of CRC specimens and 102 controls were collected from patients operated in the Surgery Department of the Fourth Hospital of Hebei Medical University during December 2007 to June 2008. The genome DNA was extracted from the leukocytes.1.2 Tissue specimens: 30 cases of CRC specimens and matched normal tissues were collected from patients matched with the blood specimens.2 Methods2.1 PCR sequence-specific primers(PCR-SSP): PCR-SSP were used for the detection of ICAM-1 genotypes in 87 patients with CRC and 102 controls. Primer sequences were as follows:Forward: l: 5'GTG GTCTGTTCCCTGGACG3' (G241);2: 5'GTGGTCTGTTCCCTGGACA3' (R241)。Reverse:3: 5'GCACATTCACGGTCACCTC3' (E469);4: 5'GCACATTCACGGTCACCTT3' (K469)。For the control GAPDH:Forward:GAAGGTGAAGGTCGGAGT;Reverse:GAAGATGGTGATGGGATTTC。2.2 Western blot analysis: Equal amounts of protein extracts from normal and CRC tissues were separated on 8% SDS-PAGE, and then blotted onto PVDF membrane. The membrane was immunologically stained with specific antibodies. The results were analyzed by digital imaging system.Results:1 The G241R polymorphism was GG genotype in all of cases and controls.2 Relationship between ICAM-1 polymorphism and clinical parametersAmong 87 patients, the positive rates of KK genotype in high and medium differentiated colorectal cancer was 53.2% (33/62), which was significantly higher than that in poor differentiated colorectal cancer 28.0% (7/25) (P<0.05). No significant correlations were found between the ICAM-1 polymorphism and gender, age, tumor location, metastasis, and Dukes stages. 3 Difference comparison of ICAM-1 polymorphisms in population of different racesThe distributions of ICAM-1 polymorphisms of G241R in population of North China were only GG genotype that is similar to those in Japanese and Korean of Asian descendants, but is different from American-European whose G allele frequencies is 0.796-0.971. However K allele frequecies in America-European population (0.437-0.630) are lower than that in Asian population(including Chinese, Japanese and Korean).4 The relationship between K469E polymorphisms and CRCThe frequencies of KK,KE and EE genotypes of K469E polymorphism were 55.5 % and 44.7%, 38.9% and 46.1%,5.7% and 9.2%,patients and controls, respectively. The frequence of KK genotype in CRC patients was significantly higher than that in controls (χ2=4.406,p=0.036),and the relative risk sufferd from CRC of KK genotype was 1.54 times of the KE+EE genotypes (OR=1.54, 95%CI:1.05~2.27). The frequency of the K allele was significantly higher in the CRC patients than that in controls (χ2=4.194,p=0.041, OR=1.58,95%CI:1.02~2.46).5 Comparative study of expression levels of the ICAM-1 proteins in cancer tissues with different genotypesWestern blot analysis showed that the level of ICAM-1 in the normal tissues of patients with KK, KE and EE genotypes respectively was not statistically significant (P>0.05); the level of ICAM-1 in colorectal cancer tissues was obviously higher than that in the matched normal tissues (P<0.05). However, the level of ICAM-1 in cancer tissues was similar to that of the matched normal tissues in patients with KE and EE genotypes. The level of ICAM-1 in colorectal cancer tissues with KK genotype was higher than that with KE+EE genotypes (P<0.05).Conclusion:1 There is not G241R polymorphism of ICAM-1 gene in Chinese.2 The K469E polymorphism of ICAM-1 gene is positively correlated with the risk of CRC.3 KK genotype is significantly associated to differentiation degree of CRC.4 The expression level of ICAM-1 in colorectal cancer tissues of patients with KK genotype is higher than that of one with KE and EE genotypes. |