Human Mesenchymal Stem Cells Differentiate Into Epidermal-like Cells In Vitro

Skin transplantation is the key to treatment of deep burned wound and skin defect caused by other factors. At present, the main skin sources needed for skin transplantation are from autogenous, allogenous, heterogenous and artificial skin. Autogenou skin is from patients themselves and can be survived perpetually without rejection after transplantation, so it is the best skin graft. However, as for patients with extensive burn, there is greater demand for skin graft than the supply of autogenous skin. Also in patients with skin defect, the skin graft donor site is becoming problem. Allogenous skin is from other persons, usually corpse. Because of the difference of histocompatibility antigens between donor and recipient, rejection will occurs in about 3 weeks after tranplantation. Heterogenous skin has shorter surviving time than allogenous skin and both also have a possible problem of carrying virus.Recently, artificial skin is an old topic and has been increasingly focused especially when the tissue engineering has developed. And the stem cell gives new hope to the tissue engineered skin as seed cell. It resolves the problems of skin resources and immune rejection, thereby it is significant in burn wound healing and repairs. The mesenchymal stem cell (MSC) especially from bone marrow can be easily obtained and is low immunogenesis and little ethical controversy, so it is a kind of perfect seed cells and attracting more and more investigators.Human bone marrow-derived mesenchymal stem cells (hMSCs) are apopulation of pluripotent cells. In response to appropriate stimuli, they can differentiate into different embryonic layer cells as osteoblasts, adipocytes, chondrocytes, tenocytes, myoblasts, neurocytes, etc. in vitro and in vivo . Is it possible that MSCs can differentiate into epidermal lineage cells? MSCs were isolated from porcine marrow, purified and cultured in vitro. After labelled with 5-bromodeoxyuridine(5—BrdU), MSCs were, by mean of injection, engrafted to epidermic and intradennic parts of the porcine. Two weeks later, immunohistochemical examination detected most 5-BrdU positive cells aggregated around small blood vessels in the dermal tissues. A few cells, which expressed keratin, appeared on the spinous and keratohyaline layers. It indicated that porcine MSCs have the potential for differentiating into epidermal cells in the skin environment. In mice and humans, Y/cytokeratin-positive cells will present in the skin of female recipients after bone marrow transplantation from a male donor . InKorbling' s study, donor-derived keratinocytes carried cytokeratin positive and CD45". However, though 4% to 14% of keratinocytes in human skin were Y~+ From the same skin biopsies, keratinocytes grown in vitro failed to demonstrate any Y~+ donor cells, even when sensitive PCR analysis for sequences specific to the Y chromosome was used . Herzog' s studies had demonstrated that BMSCs can be engrafted as proliferating (Ki67~+) keratinocytes at the wound edges, then migrate to the wound area and become part of the scar tissue , only few articles studying in vitro have been reported. The absence of an appropriate model in vitro hampered the study of early events responsible for the epidermal and dermal commitment, the cellular and molecular mechanisms of early epidermal development, and eventually the generation of donor cells for transplantation therapies. This research experiment is to find out whether hMSCs can differentiate to epidermal-like cells in vitro.Aims: To investigate the feasibility of inducing adult human bone marrow mesenchymal stem cells (hMSCs) into epidermal-like cells.Material and methodsIsolation and culture of hMSCsBone marrow was aspirated from the 20 to 45-year-old normal humans through the iliac crest. Primary human mesenchymal stem cells were isolated from those bone marrow samples by the modified Pittenger' s method (Pittenger, et al. 1999). After rinsed twice in Low Glucose-Dulbecco' s modified Eagle medium (L-DMEM;Gibco, USA), the heparinized bone marrow was loaded onto 7 ml Percoll solution (1.073 g/ml, Pharmacia, USA), and centrifuged at 2500 rpm for 30 minutes. Mononuclear cells were collected at the Percoll interface, then rinsed twice again in L-DMEM. At last, seeded at a density of 3X107cells per 25 cm'' in the flasks (Corning). HMSC medium consisted of L-DMEM supplemented with 10% fetal bovine serum (FBS;Gibco, USA) and antibiotics (penicillin-100U/ml and streptomycin-80U/ml). Non-adherent cells were removed after 24 hours, and culture media were replaced every 3 days. The cells became confluent within 7-10 days at 37° C in the humid air containing 5% C02. Adherent cells were detached by 0. 25% Trypsin & 0.02% EDTA (Gibco) at 37° C for 1 minute and subsequently passaged in the ratio of 1:3 to achieve required number. Then the cells of third passage from five human beings were used for the following protocols.Differentiation protocolsHMSCs of the third passage were seeded in the culture at a density of 5 X105 cells per 50-cm2-flask. After 24 h, half of cells were removed. The cells and the culture medium were cultured in inducing medium as experimental group. The other half of cells was cultured in the original medium as control group. The inducing medium made by us (applying for patent),consisted mainly of L-DMEM, FBS, EGF (Sigma), CaCl2 and Insulin (Sigma), etc. The inducing medium was changed every 3-4 days. They were used for the following determinations 10 days later. Morphological and histological observationThe morphologies of hMSCs were observed by phase contrast microscopy every day. For histological examination, hMSCs of the third passage were fixed in 2. 5 % glutaraldehyde and 1 % osmic acid for 1 hour respectively, following stained with 4 % acetic acid U for 30minutes, then dehydrated in a graded series of 50%, 70%, 90%, 100% alcohol and acetone. After dehydration, the fixed materials were embedded in Epon 812 and cut with Leica Ultracut UCT ultramicrotome. Specimens were double stained with acetic acid U and lead citrate fluid, and examined with Philips Tecnai 10 TEM operated at 80Kv.Immunohistochemistrical ExaminationHMSCs of the third passage were collected after digesting by trypsin-EDTA and centrifuging at 1500rpm for 5minutes. Cells were washed twice with Phosphate-buffered Saline (PBS) and fixed with 95% alcohol for 10 minutes at room temperature, and permeabilized with permeable solution for 10 minutes. After washing, cells were quenched with 3% endogenous peroxidase for 10 minutes. After washing in Tris-buffered saline (TBS, pH7. 6) three times, cells were incubated with blocking solution for 10 minutes, and then removed. Sequentially each specimen was incubated with monoclonal mouse anti-human antibodies against CK19, P63 and pan-CK for 2 hours. Subsequently, the cells were washed with TBS three times and incubated with biotin-conjugated second antibody for 10 minutes. After being washed again with TBS, cells were added into enzyme (HRP streptavidin) conjugated anti biotin solution. 10 minutes later, washed again. Proteins were displayed by AEC lately, then visualized and photographed.Flow CytometryR-PE conjugated monoclonal mouse anti-human antibodies, the P63 and P 1-integrin, were from Santa Cruz and BD Biosciences respectively. Cells were incubated with relevant antibodies at 4° C or 20 minutes. Washed with solution made of PBS, 0. l%NaN3 and 5%FBS, then analyzed on a FACS Calibur (fluorescence-activated cell sorting, Becton Dickinson). The data was analyzed with the Cell-Quest3. If software (BD).Reverse Transcriptase-Polymerase Chain Reaction104 hMSCs were examined by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Total RNAs were extracted from the two groups of hMSCs using Trizol-100 (Invitrogen). After DNase treatment, the RNA samples were purified by phenol-chloroform extraction and ethanol precipitation. RT-PCR was performed with two-step RT-PCR kit (Invitrogen). The 35 PCR cycles were used for CK19, P63 and P 1-integrin. Aliquots were run on 1.5 % agarose gels. The primer pairs used were 5' AGGTGGATTCCGCTCCGGGC3' and 5' ATCTTCCTGTCCCTCGAGCA3' for CK19, 5' AATGTTTCAGTGCAGAGCC3' and 5' TTGGGATGATGTCGGGAC3' for P 1-integrin, 5' CAGACTCAATTTAGTGAG3' and 5' AGCTCATGGTTGGGGCAC3' for ANP63 and 5' GCTCGTCGTCGACAACGGCTC3' and 5' CAAACATGATCTGGGTCATCTTCTC3' for P-actin. The bands were measured with the Quantity One software.Western BlottingHMSCs of the third passage from the two groups were washed twice with PBS and their protein was obtained by protein extraction (Pierce). Samples reduced with 10%SDS-PAGE, then transferred to PVDF membrane using western transfer system. After being blocked with 5% skimmed milk in TBST for 1 hour, the membranes were incubated with monoclonal mouse antihuman antibody of CK19 (Santa Cruz) and P 1-integrin (Serotec) for 2 hours. The membranes were washed in TBST and incubated with rabbit antimouse HRP-conjugated secondary antibody for 2 hours and then washed again anddeveloped with electrogenerated chemi luminescence (ECL) western blotting detection reagent. Proteins were visualized using Kodak X-OMAT film and analyzed by Scan Analysis.ResultMorphological and histological observationHMSCs in the control group grew to 90% confluence and attached as fibroblastic cells. While in the experiment group, after 10 days inducing, some hMSCs changed their shapes from spindle-like fibroblastic to oblate or irregular appearances under phase contrast microscopy (Olympus), and grew slowly and clonally.By transmission electron microscopic examination, the ultrastructure of the third passage hMSCs of the control group exhibited normal. The cellular cytoplasm appeared abundant, foamy and lysosomal structures. The nuclei were large and eccentric, with immature chromatin, and one or two nucleoli. In the experiment group, hemidesmosome anchorage structure was found inside the cells but did not find in the control group.Immunohistochemistry analysisAfter induction, some hMSCs were examined positive for CK19, P63 and pan~CK by immunohistochemistry in the experimental group, however, were all negative in the control group.Flow cytometric analysisIn the control group, the cells were 14.7% positive. In contrast, in the experimental group, approximately 47.6% of hMSCs were positive for P63 after induction. The expression of P1-integrin, after induction, was enhanced markedly as compared with control group. The mean of fluorescence intensity was also increased remarkably from 307.3 to 452.5, while thepositive ratio was little change. P values were both less than 0.01 by paired T test.RT-PCR analysisThe temporal gene expression pattern for a number of epidermal lineage specific genes, such as CK19, P63 and 3 1-integrin were analyzed by RT-PCR. in the experimental group, the mRNAs of CK19 and P63 genes were expressed only after induction, but were expressed negative in the control group. Gene expression level of 3 1-integrin was altered. It was detected with remarkably up-regulated in the experiment group, when compared with that in the control group.Western Blot detectionThe protein bands in the experiment group for CK19 and P63 were visible, while not visible in the control group. In the experiment group the band intensity of 3 1-integrin was further enhanced, when compared with the control group.Conclusion:HMSC can differentiate into epidermal-like cells in vitro.