| Tongue squamous cell carcinoma is the most common oral squamous cell carcinoma.Its morbidity presents a gradual upward trend in recent years and its five-year survival rate is maintained at about 50%.However,the five-year survival rate of advanced cases is only 27%.At present,its main treatment method is a multidisciplinary integrated sequence therapy focusing on surgical treatment,but surgical treatment often leads to patients' dysfunction of language,eating and breath etc.and facial deformity with a high recurrence rate and easy metastasis.Invasion and metastasis are important biological properties of tongue squamous carcinoma.The mechanism of tumor infiltration and lymphatic metastasis is a complex process consisting of multiple steps and its concrete mechanism is not clear yet.To seek for a method that not only can cure tumors effectively,but also maintain normal physiological functions of facial appearance,chew and language etc.is a difficult problem that needs to be solved urgently now.At the same time,in practical work,clinicians hope to find out biological indicators which are closely related to occurrence and development of tongue squamous carcinoma and can conduct accurate and objective evaluation on prognosis of tongue squamous cell carcinoma patients to enhance the survival rate and living quality of patients with tongue squamous carcinoma.According to lengths,non-coding RNA can be divided into two categories:non-coding short-fragment RNA(including shRNA,iRNA and piRNA)and non-coding long-fragment RNA(including Long non-noding RNA and IncRNA).The present research mainly pays attention to non-coding short-fragment RNA such as microRNA and shRNA and research on microRNA in genomes of multiple animals and plants has been reported.However,genomes of mammals can code a great quantity of non-coding long-fragment RNA(LncRNA)which is endogenous RNA which lacks a specific complete open reading frame and has no protein-coding function with a length of more than 200 nucleotides.Originally,LncRNA was considered as a by-product of transcription of RNA polymerase ? that had no biological function and was the "noise" of genome transcription.However,research in recent years showed that LncRNA took part in multiple important cell regulation processes.For example,LncRNA participates in x-chromosome silence,genomic imprinting,chromatin modification,transcriptional activation,transcriptional interference and intranuclear transport etc.In addition,in 2011,'Cancer Research'reported that LncRNA was in favor of early diagnosis,prognosis and molecular targeting treatment of tumors with good value of clinical application.Now it is regarded that functions of non-coding long-fragment RNA are as follows:(1)To interfere expression of downstream genes by transcription in the upstream promoter region of protein coding genes;(2)To form complementary double chains with transcript of protein coding genes to interfere shearing of mRNA leading to different shear forms.(3)To affect expression of downstream genes by inhibiting RNA polymerase II or mediate chromatin remodeling and histone modification.(4)To form complementary double chains with transcript of protein coding genes,further generate endogenous shRNA under the action of Dicer for gene expression level regulation.(5)To be a compound of nucleic acid protein formed by structural constituent and proteins.(6)By bonding to special proteins,the LncRNA transcript can regulate activity of corresponding proteins;(7)By bonding to special proteins,to change cytoplasm localization of proteins;(8)To be precursor molecule transcription of micromolecule RNA etc.Research in recent years showed that LncRNA played an important regulating role in occurrence and development of multiple tumors such as liver cancer,lung cancer and breast cancer.In the field of tongue squamous carcinoma research,some researchers found low expression of LncMEG3 in tongue squamous carcinoma with bad clinical prognosis,and it could inhibit the cell proliferation and cycle which result in cell apoptosis by overexpression of LncMEG3 in vitro.In addition,by studying UCA1,Fang found high expression of UCA1 in tongue squamous carcinoma and discovered that high expression of UCA1 in cancer indicated metastasis but has nothing to do with hyperplasia.All of these studies indicated that LncRNA might play a closely regulating role in occurrence and development of tongue cancer.However the the function of these ncRNAs is unknown,and the expression of AC007392.4 has not been reported in tongue squamous cell carcinomas(TSCC).Therefore,in this experiment,LncRNA AC007392.4 expression testing was firstly carried out on tongue cancer tissue and corresponding para-carcinoma tissue(20 cases)by QRT-PCR technology and found that there were expression differences in these two types of tissue.Thus,it was determined that AC007392.4 was treated as LncRNA and therapeutic targets of main function research.Moreover,by up-regulating its expression in cell strains of tongue squamous carcinoma,its effects on cell strains of tongue squamous carcinoma were observed.Therefore,this study included the following three parts.Part ? The expression analysis of long non-coding RNAs AC007392.4 in TSCC via Ion Torrent RNA-SeqObjective Explore the LncRNA AC007392.4 expression in TSCC.Materials and methodsPaired primary TSCC samples and adjacent histological normal tissues of the tongue were obtained from 20 patients who were admitted to the Department of Oral and Maxillofacial Surgery of Guangzhou Medical University of Stomatology between May 2012 and August 2013.None of the patients received radiotherapy or chemotherapy or any other treatment prior to surgery.Total mRNA samples of tongue cancer tissue and adjacent histological normal tissues were prepared with Trizol reagent(Invitrogen,Grand Island,NY 14072,USA)according to the manufacturer's instructions.First-strand cDNA was synthesized using the GeneAmp(?)PCR System 9700(Life Technologies Corporation,USA)with random hexamer primers.The resulting cDNA was amplified by using the SYBR-Green Master PCR Mix(Applied Biosystem,Grand Island,NY 14072,USA)in triplicates.Results1.The differential expression of LncRNA AC007392.4 between Cal-27 and Scc-9 cell lines and found LncRNA AC007392.4 mRNA expression in the Cal-27 cell line was significantly decreased compared with Scc-9 cell line(P<0.05).2.QRT-PCR analysis was performed on twenty paired samples of TSCC versus matched adjacent histological normal tissues to analyze differential expression of LncRNA AC007392.4.The average expression level of LncRNA AC007392.4 was significantly reduced in TSCC versus adjacent histological normal tissues(P<0.05).Conclusions1.Ion Torrent RNA-Seq is an effective way to screen the LncRNAs in TSCC,and it has low Cost,high throughput and high sensitivity traits.2.The LncRNAs expression profiles may be important targets for gene theraby in TSCC.LncRNA AC007392.4 expression was reduced in TSCC versus adjacent histological normal tissues.3.The mRNA expression of LncRNA AC007392.4 after transfection,The cells transduced with LncRNA AC007392.4 showed higher expression of LncRNA AC007392.4 than NC and Blank groups.Part? Construction of an AC007392.4-shRNA eukaryotic expression plasmid.ObjectiveUp-regulating the expression of LncAC007392.4 in cell strains of tongue squamous carcinoma,and construct shRNA-AC007392.4 plasmid.Materials and methodsLncRNA AC007392.4 were amplified by PCR according to its sequence information and then inserted into the pcDNA3.1 expression vector(Invitrogen,kpnl and EcoRI as restriction enzyme sites)at a position downstream of the CMV promoter.The cDNA of 293 cell line is used for the template of PCR amplification.The primers used to amplify this fragment are as follows:AC007392.4-F:5' CGGGGTACCCCCAAGAAGGGTGGTCTTCCAG 3';AC007392.4-R:5' CCGGAATTCGAAGACAAATGACTTTGTGTGTTGC 3'.The product size is 765 bps.Then,they were joined together to construct vectors expressing LncRNA AC007392.4.ResultsThe pLVX-shRNA1 vector,AC007392.4-siRNA and NC-siRNA were all digested with kpnI and EcoRI.Then they were putting together to construct Plasmids expressing AC007392.4-siRNA and NC-siRNA,respectively,AC007392.4-shRNA and NC-shRNA.This vector contains a central polypurine tract/central termination sequence element(cPPT/CTS),during target cell infection,this element creates a central DNA flap that increases nuclear import of the viral genome,resulting in improved vector integration and more efficient transduction.48h after transfection,cells were harvested for QRT-PCR.The expression of AC007392.4 was significantly decreased(P<0.05).Conclusions1:Construct an pLVX-shRNA target LncRNA AC007392.4 successfully,set a solid foundation for the further work in vivo and vitro.2.To determine the effect of transfection on the expression of LncRNA AC007392.4 in Cal-27 cells,the mRNA levels of LncRNA AC007392.4 were analyzed after transfection via QRT-PCR.The cells transduced with LncRNA AC007392.4 showed higher expression of LncRNA AC007392.4 than NC and Blank groups(P<0.05).Part? Effect of LncRNA AC007392.4 overexpression on Cal-27 cells functionObjectiveTo explored the potential involvement in growth regulation in cal-27 cell cell lines by up-regulating AC007392.4.Materials and methodsTSCC cell lines,Cal-27 and Scc-9 cell lines were obtained from the Department of Oral and Maxillofacial Surgery,Sun Yat-sen Memorial Hospital,Sun Yat-sen University,Guangzhou,China.293 cell line is purchased from ATCC.The cells were cultured on with 10%fetal bovine serum(FBS,Gibco),incubated at 37? and supplemented with 5%C02 in a humidified chamber.Cal-27 cells were seed onto 24-well plates the day before transfection to ensure 90%confluence at the time of transfection.Transient transfection with 4 ?g of pcDNA3.1 or pcDNA3.1-LncRNA AC007392.4 using TurboFect(Life Technologies Corporation,USA)according to the manufacturer's instructions.Moreover,cells transfected with a negative control pcDNA3.1 named "NC" group and cells left untreated as a control named "Blank" group.The mRNA expression of LncRNA AC007392.4 after transfection was detected by QRT-PCR.The cultures were harvested according to the following experiment design.The effects of LncRNA AC007392.4 overexpression on Cal-27 cells proliferation were assessed by using the Cell Proliferation Reagent Kit I(MTT)(Roche,USA).Briefly,the cells were seeded into 96-well plates(5000 cells/ml,200?l media per well).After transfection with pcDNA3.1,pcDNA3.1-AC007392.4 was added to each well and documented every 24 h following the manufacturer's protocol.An MTT solution(5mg/mL,20?L per well)was then added to the cells,and the cells were incubated for 4 h at 37?.DMSO(150?L per well)was then added,and the plates were read on an automated microplate spectrophotometer(Bio-Rad,CA,USA)at 492 nm.To explore the role of LncRNA AC007392.4 on Cal-27 cells migration and invasion,we performed a transwell assay in a 24-well culture plate.For the migration assay,at 24h after transfection,1×104 cells in serum-free media were seeded on a fibronectin-coated polycarbonate membrane insert in a transwell apparatus(Costar,Cambridge,MA,USA)and cultured in 1640 media.FBS was added to the lower chamber.For the invasion assays,×105 cells in serum-free media were seeded on an insert coated with Matrigel(BD,USA).1640 Media containing 5%PBS were added into the lower chamber.After 24h incubation,the cells remaining on the upper membrane were removed with cotton wool,whereas the cells that had migrated and invaded through the membrane were stained with 95%alcohol and 0.1%crystal violet,then imaged and counted using an inverted microscope.Cal-27 cells transiently transfected with pcDNA3.1 or pcDNA3.1-LncRNA AC007392.4 were harvested at 48 h after transfection.For cell apoptosis analysis,the fixed cells were washed and stained with propidium iodide(PI)and Annexin V-FITC,the cells were analyzed through flow cytometry using the Guava EasyCyte MiniSystem(Keygen,Nanjing,China).All the groups were performed in triplet and statistically analyzed.All experiments were performed three times in triplicates.The data were analyzed with Student's t-test.All statistical analyses were performed using the SPSS(SPSS Inc.,Chicago,IL,USA).P-value<0.05 was considered statistically significant.ResultsCal-27 cells transfected with pcDNA3.1 or pcDNA3.1-LncRNA AC007392.4 were harvested at 24h,48 h and 72h after transfection.LncRNA AC007392.4 overexpression showed higher growth rate compared with the NC and Blank groups at 48 h and 72 h(P<0.05).Moreover,there were no significant differences in the LncRNA AC007392.4,NC and Blank groups(P>0.05).Cells from LncRNA AC007392.4,NC and Blank groups were subjected to Annexin V/PI staining.The apoptosis rate in the LncRNA AC007392.4 group was significantly lower compared with the NC and Blank groups(P<0.05).ConclusionsDown regulated the expression of AC007392.4 gene inhibited proliferation and apoptosis,but has no influence on migration and invasion.Summary1:Ion Torrent RNA-Seq is an effective way to screen the LncRNAs in TSCC,and it has low cost,high throughput and high sensitivity traits.2:Definitude the differenct expression of the AC007392.4 in TSCC by QRT-PCR,and explore the relationship between the change of AC007392.4 expression and tongue squamous cancer cells function.Providing a new key approach for he biological treatment of TSCC.3:LncRNA AC007392.4 may serve as an novel therapeutic biomark for TSCC. |
PDF Full Text Request