Font Size: a A A

Expression And Roles Of Long Non-coding RNA TUC338 In Tongue Squamous Cell Carcinoma

Posted on:2016-12-06Degree:DoctorType:Dissertation
Country:ChinaCandidate:Y K X OuFull Text:PDF
GTID:1224330482456914Subject:Clinical medicine
Abstract/Summary:
Tongue squamous cell carcinoma(TSCC) is one of the most common malignant tumor in oral and maxillofacial region.And the operation, radiotherapy and chemotherapy are the conventional treatment methods.However the prognosis was not satisfactory,the five-year survival rate of TSCC was still less than 50%, and the quality of patient life is poor. Therefore, it is urgent to find the new special targets for the development of novel anticancer therapies.The human transcriptome comprises not only many protein-coding messenger RNAs (mRNAs) but also large numbers of non-protein-coding RNAs (ncRNAs).According to the lenth,the ncRNAs are devided into two classes short RNAs (<200 nucleotides) and long non-coding RNAs(lncRNAs) (>200 nucleotides).In the past study,the short RNAs including microRNAs (miRNAs), small interfering RNA (siRNA) and PIWI-interacting RNA (piRNA) were thought to be involved in essential regulators for many human physiological and pathological processes. On the other hand, the role of lncRNAs are also known to play an important role in biological processes,such as mediate chromatin remodeling% directly influence transcription and act as precursors of small RNAs.Moreover lncRNAs is associated with numbers of human diseases. Previous report show that many lncRNAs may be implicated in various tumor growth.And the transcribed ultraconserved RNAs (ucRNAs) is a group of lncRNAs that is proved be linked with leukemia, breast cancer、colorectal cancer and hepatocellular carcinoma. The expression of some LncRNAs,such as MEG3、UCA1 and Lnc-PPP2R4-5,are implicated in Tscccarcinogenesis,but their biological effects are poorly defined.The transcribed ncRNA encoding uc.338 termed TUC338, cloned as a 590-bp RNA gene,is partially located within the poly(rC) binding protein 2 (PCBP2) gene,but its expression is regulated independently of PCBP2.And in previous research TUC338 was identified as one of the most greatest change ucRNAs in in human hepatocellular cancer(HCC) and it can regulate the HCC cell growth. The transcribed ucRNAs were described explored a few years ago, Bejerano first reported that ucRNAs are absolutely conserved (100% identity with no insertions or deletions) among orthologous regions of the human, rat, and mouse genomes.Previous study showed that T-UCRs is not noly relevance to tumorigenesis, but also to neurological, cardiovascular, developmental and other diseases in human. George found that ucRNAs are frequently located at fragile sites and genomicr egions involved in cancers and maybe may be regulated by microRNAs.However the the function of these ncRNAs is unknown,and the expression of TUC338 has not been reported in tongue squamous cell carcinomas(TSCC). Therefore,in our study we first investigated LncRNAs in TSCC by Ion Torrent RNA-Seq.And then detected the expression of TUC338 in TSCC by QRT-PCR as to confirm the difference,next explored the potential involvement in growth regulation in TSCC cell lines by silencing TUC338 and subsequently examined the associated downstream gene and cytokine factors as to detected its mechanism of action. Therefore,this study included the following three parts.Part Ⅰ The long non-coding RNAs expression analysis in TSCC via Ion Torrent RNA-Seq.ObjectiveTo study the the difference of long non-coding RNA expression profiles in TSCC,as to explore the further functions of LncRNAs in pathogenesis of TSCC.Materials and methodsSelected one fresh samples of TSCC tissue and corresponding adjacent normal tongue tissue,extracted total RNA,and screened its different LncRNAs by Ion Torrent RNA-Seq.And then read the data,compared the LncRNAs sequence to the Ensemble6.8 database.Count the LncRNAs RPKM value by Tophat and Cufflinks method.Select the LncRNAs whose the value of RRPKM with a fold>10 or<0.1 compared to the adjacent normal tongue tissue as potential target biomarker.ResultsAccording to Micro Arry Gene expression profiling,we found 10346 LncRNAs high regulated,14683 LncRNAs down regulated.And after Cufflinks calculation,52 LncRNAs whose value of RRPKM with a fold>10 or<0.1 compared to the adjacent normal tongue tissue may be potential target biomarker.,which 28 LncRNAs high regulated expression,24 LncRNAs down regulated.expression.Conclusions1:Ion Torrent RNA-Seq is an effective way to screen the LncRNAs in TSCC,and it has low Cost, high throughput and high sensitivity traits.2:There are different expressed LncRNA between TSCC tissue and corresponding adjacent normal tongue tissue, the LncRNAs expression profiles may be important targets for gene theraby in TSCC.Part II Detection and analysis on LncRNA TUC338 expression in tongue squamous cell carcinoma and Construction of an TUC338-shRNA eukaryotic expression plasmidObjectiveExplore the LncRNA TUC338 expression in TSCC,and silencing TUC338 expression by RNAi,then construct shRNA-TUC338 plasmid.Materials and methodsPairs of primary TSCC and adjacent normal tissues were obtained from 15 patients, who were admitted to the Department of Oral and Maxillofacial Surgery, Guangdong Provincial Stomatological Hospital,the No.5 Affiliated Hospital, Sun Yat-sen University and Guangzhou First People’s Hospital, from May 2013 to Dec 2014. None of the patients has received radiotherapy or chemotherapy or any other treatment before operation.Tumor tissue samples and adjacent normal tissue (2.0cm distal to tumor margins at least) were snap-frozen in liquid nitrogen for QRT-PCR assay. Two TUC338 siRNA sequences were:siRNA-TUC338-1(SenseSeqL5’-UGACAGCCUGGAGACUGATT-3’,AntiSeq:5’-UCAGUCUCCAGGGCUGUCATT-3’);siRNA-TUC338-2(SenseSeq:5’-CCACAGG ACAGGUACAGCATT-3’,AntiSeq:5’-UCAGUCUCCAGGGCUGUCATT-3’);negativ e-control-siRNA(SenseSeq:5’-UUCUCCGAACGUGUACGUTT-3’,AntiSeq:5’-ACG UGACACGUUCGGAGAATT-3’)A11 the sequences were submitted to a BLAST search against the human genome to exclude the possibility of significant homology to other genes. The sequences were chemically synthesized (Shanghai Generay Biotech company)and transiently transfected into the CAL-27 a cell lines using Lipofectamine 2000 (Life Technologies Corporation, USA) according to the manufacture’s instructions.48h after transfection, cells were harvested for QRT-PCR. The TUC338-2 siRNA sequence was found to reduce the level of TUC338 mRNA to the greatest extent and was therefore selected for further study. Total RNA from tissues or cultured cells was extracted using TRIzol. First strand cDNA was synthesized with The GeneAmp(?) PCR System 9700 (Life Technologies Corporation, USA) using random hexamer primer. Quantitative PCR was performed through StepOne and StepOnePlus real-time PCR system (Life Technologies Corporation, USA). The primer set for amplifying TUC338 was as follows:TUC338: Forward(5’-3’):GGTGAGAGGGGATGTTCAGT;Reverse(5’-3’):TGGGTGAAATGA GGTTGGGG. At the end point of PCR cycles, melt curves were made to check product purity. The level of TUC338 was expressed as a ratio relative to the P-actin mRNA in each sample. Delta-delta Ct values were used to determine their relative expression.Results1:Tumor tissue samples and adjacent normal tissues were detected by QRT-PCR assay.The average expression levels of TUC338 were significantly increased in tumor tissues compared with adjacent normal tissues (P<0.05). 2:The pLVX-shRNA1 vector, TUC338-siRNA and NC-siRNA were all digested with BamHI and EcoRI. Then they were putting together to construct Plasmids expressing TUC338-siRNA and NC-siRNA, respectively, TUC338-shRNA and NC-shRNA. This vector contains a central polypurine tract/central termination sequence element (cPPT/CTS), during target cell infection, this element creates a central DNA flap that increases nuclear import of the viral genome, resulting in improved vector integration and more efficient transduction.48h after transfection, cells were harvested for QRT-PCR.The expression of TUC338 was significantly decreased(P<0.05).Conclusions1:The expression of LncRNA TUC338 was higher in TSCC, suggested that TUC338 may be an important therapeutic biomark.2:Construct an pLVX-shRNA target LncRNA TUC338 successfully, set a solid foundation for the further work in vivo and vitro.PartⅢ Silencing of TUC338 gene inhibited proliferation apoptosis of cal-27 and scc-9 cell lines and infunced the associated downstream geneObjectiveTo explored the potential involvement in growth regulation in cal-27 and scc-9 cell cell lines by silencing TUC338 and then examined the associated downstream gene and cytokine factors as to detected its mechanism of action.Materials and methodsThe cal-27 and scc-9 cell lines were obtained obtained from the Department of Oral and Maxillofacial Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, China,which have been studied previously, were grown with 10% foetal bovine serum (FBS)(Gibco). Cells were invubated at 37℃ and supplemented with 5% CO2 in the humidified chamber.,we transfected short hairpin RNA (shRNA) targeting TUC338 into CAL-27 and SCC-9 cell lines using lentiviruses, tumor cell growth was determined by MTT, apoptosis and cell-cycle phases were determined by flow cytometry, migration and invasion ability were determined by transwell migration assay and transwell invasiveness assay respectively. Further analysis associated genes STAT1、p-STAT1、AKT、p-AKT and Caspase-3 were detected by Western blotting. And GAPDH gene was served as the internal reference.ResultsSilencing TUC338 can inhibites TSCC cell growth.As demonstrated by MTT assay, The inhibition rates in NC/SH groups in the CAL-27 cell line were 3.15±12.75% /58.26±13.87% and in the SCC-9 cell line were 6.05±12.58% /61.94±12.06%;sh-TUC338 significantly inhibited cell growth rate compared with the NC group after 72 h in the CAL-27 and SCC-9 cell lines(P<0.05).Migration and invasion were determined by transwell assay,but analysis revealed no significant changes between NC and SH groups cells (P> 0.05). Apoptosis was detected via flow cytometry assay, and the analysis showed that the rates of apoptosis in Blank, NC and SH groups in the CAL-27 cell line were 5.79±0.15%,6.61±0.24%, and 19.20±0.03%, respectively, whereas in the SCC-9 cell line, they were 9.43±0.89%,10.22±0.55% and 13.41±0.38%.The percentage of apoptosis in the sh-TUC338 group compared with the NC and Blank groups was significantly higher in both the CAL-27 and SCC-9 cell lines (P<0.05). The proportions of cells in different phases of the cell cycle were determined via flow cytometry after staining the cells with PI. The analysis showed that G2/M phase arrested in SCC-9(P<0.05),but there was no differences in S phase both in CAL-27 and SCC-9 cell lines response to silencing TUC338 (P>0.05).Fuethermore, sh-TUC338 attenuated STATl,p-STAT1,AKT, and p-AKT expression and induced the activation of Caspase-3.ConclusionsDown regulated the expression of TUC338 gene inhibited proliferation and apoptosis,but has no influence on migration and invasion.Meanwhile it could influnced associated downstream gene.Summary1:Ion Torrent RNA-Seq is an effective way to screen the LncRNAs in TSCC,and it has low cost, high throughput and high sensitivity traits.2:Definitude the differenct expression of the TUC338 in TSCC by QRT-PCR,and explore the relationship between the change of TUC338 expression and tongue squamous cancer cells function. Providing a new key approach for he biological treatment of TSCC.3:LncRNA TUC338 may serve as an novel therapeutic biomark for TSCC.
Keywords/Search Tags:Long non-coding RNA, TUC338, TSCC, RNA interference
Related items