Transcriptional Activation Of PD-L1 By SOX2 Contributes To The Proliferation Of Hepatocellular Carcinoma Cells

Hepatocellular carcinoma(HCC)is one of the most lethal malignant tumors in the world.During the past decades,a plenty of researchers regarding the genetic markers(i.e.abnormal gene expressions as well as the genomic aberrations)have been accumulated for the research of HCC.The primary risk factors for the pathogenesis of HCC have been elucidated,and the multiple steps involved in hepatocarcinogenesis have been well defined in recent years.In spite of these associations between the risk factors and the development of HCC has been well-established,no clear picture of the actual mechanisms of how and what consequences these factors lead to malignant transformation has emerged yet.SOX2 is a transcription factor that controls the expression of a number of target genes through forming a trimeric complex with OCT4 on DNA.Until now,the relationship between SOX2 and tumorigenesis as well as overall survival has been well elucidated in several solid tumors,such as breast,esophageal and lung cancer.In addition to this,SOX2 has also been implicated in the progression of HCC.For instance,the expression levels of SOX2 and its co-factor OCT4 correlate with an aggressive phenotype and low survival rate of HCC.HCC cells overexpression SOX2 are characterized by increased ability of epithelial-mesenchymal transition(EMT),invasion and clonal formation.MiR126,which is a tumor suppressor,inhibits cell growth through reducing the expression of SOX2.These studies indicate that SOX2 functions as an oncogene in HCC.However,it is still unclear through which pathway SOX2 promotes tumorigenesis.PD-L1(also known as B7-H1),a gene encodes an immune inhibitory receptor ligand,is expressed in various types of cancer and immune cells.Binding of PD-L1 to its receptor PD-1(the programmed cell death-1 receptor)leads to tumor evasion from host immune system,which is achieved through suppressing T-cell response,migration,proliferation and restricting the tumor cell killing ability of T cell.Immunotherapeutics targeting the PD-L1/PD-1 pathway are currently in clinical trials and have shown impressive response rates in patients,particularly for non-small-cell lung cancer(NSCLC),bladder cancer,renal cell carcinoma and melanoma.It has been reported that the PD-L1 expression in HCC is significantly associated with tumor malignancy and the risk of postoperative recurrence.Therefore,PD-L1 might represent a potential target for HCC immunotherapy as well as a biomarker that aids in determining the prognosis both before and after therapy.In this study,we investigate the expression and transcriptional regulation of SOX2 and PD-L1 in HCC.We report that the expression level of SOX2 and PD-L1 is higher in HCC tissues and cell lines in compared with adjacent non-tumor tissues and normal liver cell lines.Furthermore,the expression of SOX2 and PD-L1 in HCC tissues are positively correlated with each other.Functionally,we also demonstrate that knockdown of SOX2 reduces the cell vitality,arrests the cell growth and induces the apoptosis of HCC cell lines.Also,SOX2 regulates the expression of PD-L1 through directly binding to the SOX2 consensus binding site on PD-L1 promoter region and regulating the promoter activity of PD-L1.This study describes the crucial role of SOX2 in HCC,and for the first time lucubrates the relationship between SOX2 and PD-L1.Objection:In this study,we explored the expression,function and the relationship between SOX2 and PD-L1 in HCC.Methods:Cell culture.HL-7702,HepG2,SMMC7721,Huh7 and HEK293 cells were cultured in DMEM containing 10%fetal bovine serum.RNA extraction and reverse transcription-quantitive PCR(RT-qPCR).Total RNA of cell lines(HL-7702,HepG2,SMMC7721,and Huh7)and patient tissues(hepatocellular carcinoma tissue and adjacent non-tumor tissue)were extracted using RNeasy Mini Kit according to the manufacturer's protocol.RNase-free DNase I were used to remove genomic DNA.Reverse-transcription was carried out with the Superscript III Reverse Transcriptase.QPCR assays were performed with the SYBE Premix Ex TaqTM on ABI ViiA 7 Real-time PCR System.The relative expression level of SOX2 and PD-L1 were calculated as 2-[Ct[(Gene)-Ct(GAPDH].Each assay was performed three times.RNA interference(RNAi).Lipofectamin TM 2000 was used for siRNA delivery.SMMC7721 and HepG2 cells(2.5 × 105)were seeded in 6-well plate one day before transfection.A total amount of 100 pmol siRNA were diluted with 250 ?l of DMEM without serum and mixed gently.A total amount of 5 ?l Lipofectamine TM 2000 were mixed with 250 ?l of DMEM and incubated for 5 minutes at room temperature.Then the diluted RNA and the diluted LipofectamineTM 2000 were firstly mixed gently and incubated for 20 minutes at room temperature.After 20 minutes incubation,500 ?l of DMEM/Lipo/siRNA mix were added to each well containing cells,and mixed gently.The cells were then incubated in a CO2 incubator contained 5%CO2 at 37?.Cells were collected after 72 hours of transfection for mRNA and protein extraction.A SOX2 specific siRNA sequence(siSOX2:5'-CGGCUCUGUAUUAUUUGAATTA-3')was used for RNA interference.A mismatch siRNA sequence(siNC:5'-UUCUCCGAACGUGUCACGUTT-3')was used as negative control.Cell proliferation assay.Cell proliferation was detected by the CCK8 and EdU assays.CCK8.The cell viability of HepG2 and SMMC7721 cells was detected by the Cell Counting Kit 8.Briefly,10 ?l of CCK8 reagent was added at the 24,48 and 72 hours siRNA posttransfection.Then cells were incubated at 37? for 4 hours,and the number of viable cells was evaluated through measuring absorbance at 450 nm.EdU staining.HepG2 and SMMC7721 cells that transfected with siRNA were used for EdU assay with Cell-LightTm EdU kit according to the manufacturer's protocol.Images were captured using a Leica Microscope.Apoptosis analysis.SiRNA-transfected HepG2 and SMMC7721 were collected for apoptosis analysis.Annexin V-FITC and PI were used for detection of apoptotic cells.ElectSrophoretic Mobility Shift Assay(EMSA).EMSA was performed using Lightshift Chemiluminescent EMSA kit according to the manufacturer's instructions.Biotin-labeled double-stranded oligonucleotide(5'-TATGACACCATCGTCTGTCATC-3')containing the consensus SOX2 motif was used as EMSA probe.An unlabeled double-stranded oligonucleotide was used as competitor probe.An unlabeled-mutated oligonucleotide(5'-TATGACACGTACCACTGTCATC)was used as negative competitor probe.Nuclear protein was extracted from HepG2 cells.Anti-SOX2 antibody was used to supershift the DNA-protein complex.Chromatin immunoprecipitation-quantitative-PCR(ChIP-qPCR).ChIP was performed according to the manufactures manual in HepG2 cells with the anti-SOX2 antibody.The qPCR assay was carried out with the SYBE Premix Ex TaqTM on ABI ViiA 7 Real-time PCR System.Normal rabbit IgG was used as negative control.ChIP-qPCR assay was performed in triplicate.The primers used for ChIP-qPCR are as follows:PD-L1(for ChIP-qPCR)-F:AAGAAAAGGGAGCACACAGGPD-L1(for ChIP-qPCR)-R:GCCCAAGATGACAGACGATGPlasmid.The PD-L1 promoter region was PCR amplified from HepG2 cells and cloned into the pGL3-basic vector(PD-L1-WT).Mutation of the SOX2 binding site on PD-L1-WT was performed by Quik Change Site Mutagenesis Kit according to the manufacturer's manual.Human SOX2 cDNA was amplified from HepG2 cells by RT-PCR and cloned into the pSG5 vector.The primers used for cloning are as follows:PD-L1-Promoter-F:GGGGTACCAGAAGGAAAGGCAAACAACPD-L1-Promoter-R:CCGCTCGAGCTTTGGGTTAGTGAATGGGPD-L1-Mutation-F:TACTTAAGTAAATTATGACATGCAGACGTGTCATCTTGGPD-L1-Mutation-R:CCAAGATGACACGTCTGCATGTCATAATTTACTTAAGTASOX2-cDNA-F:CGGGATCCTCTTCGCCTGATTTTCCTCGSOX2-cDNA-R:GGAATTCCCTCCCATTTCCCTCGTTTTLuciferase.HEK293T cells were transfected using LipofectaminTM 2000.Luciferase activity was detected by the Dual Luciferase Assay after 24 hours of transfection.Co-transfection of Renilla luciferase plasmid was used as the internal control for transfection efficiency.Results:SOX2 and PD-L1 expression are significantly higher in hepatocellular carcinoma(HCC)tissues than in adjacent non-tumor tissues.We initially compared SOX2 and PD-L1 expression in HCC tissue samples and that in adjacent non-tumor tissue samples.We firstly performed RT-qPCR and western blotting to measure SOX2 and PD-L1 expression in HCC tissues versus adjacent non-tumor tissues from HCC patients.SOX2 expression in HCC tissues was significantly higher than that in adjacent non-tumor tissues in both mRNA and protein levels.PD-L1 showed the similar expression pattern as SOX2,To confirm this expression pattern,we conducted immunohistochemistry(IHC)staining to detect the SOX2 and PD-L1 protein in the HCC tissue and adjacent non-tumor tissue samples.As compared with normal tissue,the SOX2 and PD-L1 signal is stronger in HCC tissue.Altogether,these analyses prompt us that the expression of SOX2 and PD-L1 might be correlated with each other.Thus,we further lucubrated the relationship between the expression level of SOX2 and PD-L1.The expression level of SOX2 was positively correlated with that of PD-L1(r = 0.692).Collectively,these results suggest that both Soxl and PD-L1 are highly expressed in HCC tissue,and their expression are positive co-related with each other.SOX2 and PD-L1 expression are significantly higher in HCC cell lines than that of normal liver cell line.We firstly performed RT-qPCR to measure the mRNA level of SOX2 and PD-L1 in HCC cell lines(Huh7,SMMC7721,and HepG2)and normal liver cell line(HL-7702).SOX2 and PD-L1 expression in HCC cell lines were significantly higher than that in the normal liver cell line.Secondly,we analyzed the protein level of both proteins through western blotting assays.The protein level of SOX2 and PD-L1 were higher in HCC cell lines than that in the normal liver cell line.Moreover,we performed immunofluorescence assays to visualize the expression of SOX2 and PD-L1 globally.Both SOX2 and PD-L1,even though they localized in the different cellular component,showed higher fluorescence intensity in HCC cell lines than in normal liver cell line.These data are consistent with the aforementioned results and provide strong evidence that SOX2 and PD-L1 are both highly expressed in HCC.Knockdown of SOX2 represses the proliferation growth and induces the apoptosis of HCC cells.The findings that SOX2 was highly expressed in HCC cells prompted us to elucidate the biological function of SOX2 in HCC.We utilized a siRNA approach to knockdown SOX2 expression in two SOX2 highly expressed HCC cell lines(HepG2 and SMMC7721),and compared the cell proliferation ability and the status of cellular apoptosis before and after SOX2 knockdown.The reduction of SOX2 expression in SOX2-specific siRNA transfected cells was confirmed by qRT-PCR and western blotting assays.The effect of SOX2 depletion on cell proliferation was evaluated through using CCK8 and EdU assays.We observed a significant decrease in proliferation after transfection of siSOX2 in both HepG2 and SMMC7721 cells.SOX2 knockdown also led to the apoptosis of HCC cells,based on the observations of the percentage of the Annexin V-positive and PI-negative cells(increased from 8.3%to 31.0%and 10.0%to 29.4%,in HepG2 and SMMC7221 after SOX2 knockdown,respectively).Taken together,these data indicate that the SOX2 oncogene is required for the proliferation and growth of HCC cells.SOX2 transactivates PD-L1 through the-757 region of the PD-L1 promoter.Next,we asked whether SOX2 regulates the expression of PD-L1.Through RT-qPCR and western blotting,we found that the expression level of PD-L1 was significantly decreased after SOX2 knockdown,which indicated that the expression of PD-L1 might be regulated by SOX2.One important problem that remains to be clarified is whether SOX2 directly target the PD-L1 promoter in HCC cells.To address this question,we first investigated the transcription factor binding sites within the promoter region of PD-L1 using the TRANSFAC database.Interestingly,we found a consensus SOX2 motif on the upstream of the transcription start site(TSS)at position-757.Then we performed in vitro EMSA and in vivo ChIP-qPCR assay on SOX2 motif containing promoter regions.When a 22 bp probe contained the SOX2 motif was incubated with nuclear extracts from HepG2,a specific DNA-protein complex was observed and was supershifted by the anti-SOX2 antibody.This indicated that SOX2 bound to the promoter regions of PD-L1 directly through the SOX2 motif.This was further verified by ChIP-qPCR assays in HepG2 cells using primers marked and antibodies against SOX2.To further investigate whether SOX2 transactivates the regulatory region of PD-L1 through the SOX2 binding site identified above,we performed luciferase reporter assays in HEK-293T cells.We cloned the promoter region of PD-L1 that contained SOX2 motif and TSS into a luciferase reporter plasmid,which was defined as pGL3-PD-L1.Meanwhile,we also constructed a pGL3-PD-Ll-mutant plasmid,in which the core sequence of SOX2 motif around-757 bp was mutated from CCATCGTC to TGCAGACG.Co-expression of SOX2 resulted in significant activation of the PD-L1 promoter region.In contrast,the transactivation ability of SOX2 on the PD-L1 promoter region was significantly reduced as observed in the PD-L1 mutant promoter.Collectively,the data indicate that SOX2 could transactivate the PD-L1 promoter through the SOX2 motif located at the-757 bp upstream of TSS.Conclusion:Both SOX2 and PD-L1 were expressed at a markedly higher level in HCC tissues in comparison to adjacent non-tumor tissues.Moreover,the expression levels of both genes were correlated with each other.Knockdown of SOX2 reduced the cell proliferation ability and induces the apoptosis of HCC cells,suggesting the function of SOX2 in regulating both the cell proliferation and apoptosis.Interestingly,the depletion of SOX2 also reduced the expression of PD-L1.Further analysis showed that there is a consensus SOX2 binding site in the promoter region of PD-L1.Through in vitro EMSA assay and in vivo chromatin immunoprecipitation assays,we demonstrated that SOX2 directly bound to the PD-L1 promoter through the consensus SOX2 motif.Further evidence by luciferase reporter assays revealed that SOX2 promoted the transcription activity of PD-L1 promoter region through the SOX2 motif.Collectively,our data provide a novel insight into the function and the interplay of SOX2 and PD-L1 in HCC.