Role Of AMPK/AP-2?/IkB? In Anti-atherosclerosis And Related Drug Intervention

1 IntroductionAtherosclerosis is a multistep disease that involves chronic inflammation at every stage, from initiation to progression and, eventually, plaque rupture, thrombosis, and occlusion of the vessel. In the early stage of atherosclerosis, the abnormal homeostatic functions of the endothelium are appeared, promoting an inflammatory response. Later in the process, mediators of inflammation can weaken the fibrous cap of the atheroma, possibly leading to the formation of thrombosis and the coming of acute coronary syndromes such as unstable angina pectoris and myocardial infarction. Therefore, inflammation is a therapeutic target in atherosclerosis.AMP-activated protein kinase (AMPK) is a serine/threonine kinase consisting of ?, ?, and ? subunits, each of which has at least two isoforms. The a subunit contains the catalytic activity, while the ? and ? regulatory subunits maintain the stability of the heterotrimer complex. Both AMPK?1 and ?2 increases nitric oxide release by phosphorylating endothelial nitric oxide synthase (eNOS) in endothelial cells, suggesting AMPK might be important in maintaining endothelial function. Some studies have indicated that reduction of AMPK?2 accelerated the initiation and formation of atherosclerosis in mice by increasing I?B? degradation, resulting in subsequent NF-?B activation and excessive NADPH oxidase-derived reactive oxygen species (ROS) productions.Activator protein 2? (AP-2?) is a transcription factor which recognizes the consensus sequence of GCCNNNGGC. Although AP-2? is phosphorylated at serine 33 by protein kinase A or serine 252/320 by protein kinase D, some study found that AP-2? is a direct substrate of AMPK?2, which is serine 219 specific. Based on above observations, we address these questions by in vitro and in vivo studies to determine the effects and molecular mechanisms of AMPK activation in the growth and stability of atherosclerotic plaque of metformin. We suggest that AP-2a, as a transcriptional factor of I?B?, mediates the suppressive effects of AMPK activation in all stages of atherosclerosis, including growth and instability of plaque.2 Objectives(1) After activation of AMPK, the expression of IkBa was up-regulated by AP-2a;(2) To investigate whether AP-2a-dependent upregulation of IkBa gene transcription is involved in the novel molecular mechanism by which metformin inhibits atherosclerosis.3 Methods3.1 Detection of protein and DNA interaction by in vitro EMSA.The in vitro EMSA kit is from Invitrogen. DNA is from PCR production after purification. Recombinant protein was incubated with DNA for 30 min at room temperature in reaction buffer. The reaction mixture was separated by running non-denaturing gel electrophoresis. The gel was stained by SYBR Green for DNA detection and SYPRO Ruby for protein detection, respectively.3.2 ChIP assay for transcriptional factor and gene promoter bindingChIP assays were performed by using a ChIP-IT kit, according to the manufacturer's protocol.1×106 cells were seeded on a 10cm dish. Proteins were cross-linked to DNA by adding formaldehyde directly to culture medium at a final concentration of 1% and incubating for 10 min at 37?. The cells were harvested in SDS lysis buffer and added protease inhibitors. Cell lysates were sonicated to shear DNA to lengths between 200 and 1000 bp. Sheared chromatin was precleared with protein G beads prior to incubation overnight at 4? with 4 ?g of anti-NF-?B antibody and anti-AP-2a antibody, or control IgG antibody. Purified, immunoprecipitated chromatin fragments from IP samples were subjected to PCR. PCR products were subjected to agarose gel electrophoresis and stained with ethidium bromide.3.3 Cell culturesMouse vascular smooth muscle cells (MOVAS) from ATCC were grown in basal medium supplemented with 2% FBS, penicillin(100U/ml), and streptomycin (100?g/ml). All cells were incubated at 37? in a humidified atmosphere of 5% CO2 and 95% air. Cells were grown to 60-70% confluency before being treated with different agents.3.4 Generation of shRNA construct and lentivirus productionBased on the protocol from Signaling Gateway, the shRNA cassette containing target sequence of AP-2a (GGAGAGCGAAGTCTAAGAATG) was designed.3.5 Animals and protocols of in vivo experimentsAnimal model consisted of two parts.(1) Male Apoe-/- mice at age of 8-12 weeks were infected with lentivirus containing negative control shRNA or AP-2a shRNA via tail vein and received a high fat diet (15% cocoa butter and 0.25% cholesterol). After 4 weeks, metformin (300 mg/kg/day per mouse) was added into drinking water and maintained for 8 weeks. After the experiment, mice were euthanized through the intraperitoneal injection with 0.8% pentobarbital sodium at 60 mg/kg, followed by cervical dislocation. The aortas were collected for histological and molecular biological analysis.(2) Male Apoe-/-mice at age of 8-12 weeks had right carotid collar placement plus local lentivirus infection. After surgery, mice were fed a high fat diet.4 weeks later, mice received metformin administration in drinking water (300 mg/kg/day) and injection of lentivirus (once every 4 weeks) and kept for 8 weeks. The left common carotid arteries were collected for pathological and molecular biological analysis.3.6 Body weight and Serum lipid profileAt the end of the experiment, the concentrations of triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoproteinc holesterol (LDL-C) in serum were measured. Also, we measured all mice body weight.3.7 Immunohistochemistry of frozen sections analysisThe aorta roots and carotid arteries cryosections were stained using H&E, Sirius red, oil-red O. Immunohistochemical analysis including macrophages, SMCs, AP-2a, 4-HNE,3-NT, Nox4, p47, I?B? were did also. We calculated the vulnerable index according to the formula:the positive staining area of (lipid%+macrophages%)/the positive staining area of (collagen%+?-SMCs%).3.8 Western blot analysisCell lysates or tissue homogenates were subjected to western blot analysis. The protein content was assayed by BCA protein assay reagent. Protein of 20?g was loaded to SDS-PAGE and then transferred to membrane. Membrane was incubated with a 1:1000 dilution of primary antibody, followed by a 1:5000 dilution of horseradish peroxidase-conjugated secondary antibody. Protein bands were visualized by ECL.4 Results4.1 AP-2a binds to human I?B? gene promoter DNABy analysis of human I?B? gene promoter nucleotide sequence, we found a binding site of AP-2a in the 5'flanking region of human IKBa gene, which is GCCCGCGGC. Next we determined whether AP-2a binds to this site directly by in vitro EMSA. By incubation of I?B? gene promoter fragments (200 bp and 1400 bp), which both contain AP-2a binding site, with recombinant AP-2? protein in vitro, we observed the obvious shift of DNA or AP-2a protein when we separated the reaction mixture on native gel by electrophoresis, compared to the original position. It indicates that AP-2a is a potential transcriptional factor for I?B? gene transcription.4.2 AMPK activation promotes the affinity of AP-2a toI?B? gene promoter We next investigated if AP-2a can bind to I?B? gene promoter in cultured cells in AICAR-treated HUVECs by EMSA. AICAR treatment increased the DNA affinity of AP-2a in nuclear extracts in both basal and TNFa-stimulated HUVECs. However, the effect of AICAR on increased AP-2a activity in TNFa-stimulated HUVECs is much stronger than in basal HUVECs. Similar to the increased AP-2a DNA affinity, the increased binding of AP-2a to I?B? gene promoter was observed in basal and TNFa-stimulated HUVECs.4.3 AMPK activation increases AP-2a serine 219 phosphorylation and I?B? protein expression in MOVASMouse vascular smooth muscle cells (MOVAS) grown to 60-70% treated with 1mM AICAR to 24 houres. We found AMPK activation enhanced AP-2a serine 219 phosphorylation and I?B? protein level.4.4 AMPK activation induced upregulation of I?B? protein expression is AP-2a-dependent in MOVASTo examine the key role of AP-2a serine 219 in AICAR-increased I?B? protein expression, we infected MOVAS with Control shRNA and AP-2a shRNA to knockdown AP-2a expression. As expected, AICAR increased I?B? protein level in cells transfected with control shRNA, but not transfected with AP-2a shRNA. Taking these data together, it reveals that AP-2a serine 219 phosphorylation is required for AICAR-induced I?B? expression.4.5 AMPK activation reduces ROS production in TNFa-stimulated MOVAS, which is AP-2a dependentWe etermined whether AMPK activation via AP-2? serine 219 phosphorylation to inhibit ROS production induced by TNFa. Consistent with other reports, treatment of MOVAS with TNFa significantly increased the ROS production. As expected, AICAR co-treatment suppressed the ROS production. However, AP-2a siRNA abolished the effect of AICAR on ROS production. Taking these data together, it reveals that AMPK activation by AICAR suppresses ROS production through AP-2a phosphorylation.4.6 Metformin increases phosphorylation of AP-2a in Apoe-/-- mice300 mg/kg/day metformin, remarkably increased AP-2a phosphorylation in vivo, supporting an important role of AP-2a in the protective effects of metformin on atherosclerosis.4.7 Lentivirus-mediated RNA interfere of AP-2a abolishes the suppressive effects of metformin on atherosclerotic plaque growth in Apoe-/- miceAP-2a shRNA treated mice had significantly higher lesion areas in the aorta and aortic arch than control shRNA treated mice. Metformin significantly suppressed whole aortas and aortic arch lesion areas in Apoe-/- mice infected with control shRNA lentivirus, but had no significant suppression in Apoe-/-- mice infected with AP-2a shRNA lentivirus.4.8 Knockdown of AP-2a ablates the effects of metformin on maintaining atherosclerotic plaque stability in Apoe-/- miceMetformin increased the plaque stability in Apoe-/- mice. Metformin could not suppress plaque instability in the AP-2a shRNA treated mice. These data demonstrate that AP-2a is essential for atherosclerotic plaque stability induced by metformin.4.9 Metformin via AP-2a enhances IkBa protein and reduces oxidative stress in Apoe-/-miceMetformin dramatically increased IkBa protein level and reduced the levels of p47, Nox4 and 4-HNE in carotid arteries from Apoe-/-mice infected with control shRNA.5 Conclusion(1) AP-2a activation upregulate IkBa gene expression.(2)Metformin alleviates atherosclerotic plaque growth and instability via activation of AP-2a expression up-regulated genes IkBa to inhibit inflammation and reduce oxidative stress.1 IntroductionAtherosclerosis, formerly considered an ongoing inflammatory response. In the early stage of atherosclerosis, the abnormal homeostatic functions of the endothelium appear and promote an inflammatory response. Later in the process, increased inflammation stimulates enlargement of the plaque lesion weakening the protective fibrous cap of the atheroma, possibly leading to thrombosis and the occurrence of acute coronary syndrome.Activating enhancer binding protein 2 alpha, also called activator protein 2a (AP-2a), is a member of the AP-2 transcription factor family proteins consisting of ?, ?,?y,?, and ? subunits. Mice deficient in AP-2 die after birth due to the abnormal skeletal and neural tube development, indicating a critical role of AP-2 in mammals. AP-2a recognizes the consensus DNA sequence of 5'-GCCNNNGGC-3'found in a number of genes involved in various cell functions. The biological role and clinical relevance of AP-2a in atherosclerosis have not been elucidated.The ancient drug aspirin reduces the risks of cardiovascular disease (CVD) in part by its anti-inflammatory and antiplatelet effects via the inhibition of cyclooxygenase (COX) enzyme. The efficacy of aspirin for prevention of CVD is well established, but the mechanism of anti-atherosclerosis is unclear.Aspirin activates AMP-activated protein kinase (AMPK) in vascular cells. Previously, we have shown that activation of AMPK increases AP-2a phosphorylation in vascular smooth muscle cells (VSMC) and suppresses the formation of atherosclerotic plaques in mice. Based on these studies, we hypothesize that aspirin induces AP-2a phosphorylation leading to attenuation of the progression of atherosclerosis, including the growth and instability of plaque. In this study, we provided evidence that AP-2a is crucial to the anti-inflammatory effects of aspirin. Given the significant effects of aspirin-induced AP-2a activation on plaque growth and stability, AP-2a may be an attractive target for the prevention of diseases related to the rupture of atherosclerotic plaques, such as stroke or myocardial infarction clinically.2 Objectives(1) To identity AP-2a is the transcriptional factor of IkBa;(2) To investigate AP-2a-dependent upregulation of IkBa gene transcription is involved in the novel molecular mechanism by which aspirin inhibits atherosclerosis.3 Methods3.1 Generation of shRNA construct and lentivirus production Based on the protocol from Signaling Gateway, the shRNA cassette containing target sequence of AP-2a (GGAGAGCGAAGTCTAAGAATG) was designed.3.2 Animals and protocols of in vivo experimentsOur animal model consisted of three parts including high-fat diet induced aortic atherosclerosis, carotid collar induction of vulnerable plaques, and lentiviral knock down of AP-2a.(1) Apoe-/- mice at age of 8-12 weeks had a collar placed around the right common carotid artery. Briefly, we placed a shrunk silicone tube around the right common carotid artery near its bifurcation. Mice were then fed with a high fat diet (0.25% cholesterol and 15% cocoa butter) plus aspirin administration (5,20,50 mg/kg/day) in drinking water for 8 weeks. At the end of experiment, all mice were sacrificed under anesthesia.(2) Male Apoe-/- mice at age of 8-12 weeks were infected with lentivirus containing negative control shRNA or AP-2a shRNA via tail vein and received a high fat diet. 4 weeks later, aspirin (50 mg/kg/day per mouse) was added into drinking water and maintained 8 weeks.After the experiment, mice were euthanized followed by cervical dislocation. The aortas were collected for histological and molecular biological analysis.(3) Male Apoe-/-mice at age of 8-12 weeks had right carotid collar placement plus local lentivirus infection. After surgery, mice were fed a high fat diet. After 4 weeks, mice received aspirin administration in drinking water (50 mg/kg/day) and injection of lentivirus (once every 4 weeks) and kept for 8 weeks. The left common carotid arteries were collected for pathological and molecular biological analysis.3.3 Body weight and Serum lipid profileAt the end of the experiment, body weights and blood lipids of all mice were measured.3.4 Cell culturesHuman vascular smooth muscle cells (VSMCs) from ATCC were grown in basal medium supplemented with 2% FBS, penicillin (100U/ml) and streptomycin (100?g/ml). All cells were incubated at 37? in a humidified atmosphere of 5% CO2 and 95% air. Cells were grown to 70-80% confluency before being treated with different agents.3.5 Generation and infection of adenoviral infection to cellsTo generate adenoviral vector containing Ad-S219A-AP-2a cDNA, we subcloned a human cDNA encoding full-length of AP-2a, which contained a substituted amino acid of serine 219 to alanine (S219A), into a shuttle vector (pShuttle CMV [cytomegalovirus]). VSMCs were infected with adenovirus overnight in medium supplemented with 2% FBS.3.6 Reverse transcription PCRTotal cellular RNA was isolated using a Qiagen reagent and reverse transcribed to cDNA with specific antisense primers using the ThermoScript RT-PCR System protocol. Samples (2 ?l) of reverse transcribed product were PCR-amplified in a total volume of 25 ?l with 10 pmoles each offorward and reverse primer.3.7 Western blot analysisCell lysates or tissue homogenates were subjected to western blot analysis. The protein content was assayed by BCA protein assay reagent. Protein of 20 ?g was loaded to SDS-PAGE and then transferred to membrane. Membrane was incubated with a 1:1000 dilution of primary antibody, followed by a 1:5000 dilution of horseradish peroxidase-conjugated secondary antibody. Protein bands were visualized by ECL.3.8 Electrophoretic mobility shift assay (EMSA) for AP-2a and NF-?B DNA-binding activitiesSubcellular fractions were prepared by using NE-PER Nuclear and Cytoplasmic Extract kit (Cat78833) from PIERCE. EMSA were performed by using AP-2a kit of Panomics Company and NF-?B kit of Promeag Company.3.9 ChIP assay for transcriptional factor and gene promoter binding ChIP assays were performed by using a ChIP-IT kit according to the manufacturer's protocol.3.10 Histopathological analysisContinuous cryosections of the carotid arteries were stained with Sirius Red, Oil Red O, HE. In addition, frozen sections were subjected to immunohistochemical analysis including Nox4, p47, I?B?, macrophages, SMC, AP-2a,4-HNE. The vulnerability index was calculated by the relative area of positive staining area.3.11 Measurement F2-isoprostanes in urine and bloodThe concentration of F2-isoprostanesin urine or blood was determined by LC-MS/MS.4 Results4.1 Aspirin attenuates the growth of atherosclerotic plaque in Apoe-/- miceWe firstly tested the dose response of aspirin (5,20, or 50 mg/kg/day) on the suppression of atherosclerotic lesion formation in Apoe-/- mice fed a high fat diet for 8 weeks.5mg/kg/day aspirin did not reduce the size of atherosclerotic Plaque.20 and 50 mg/kg/day aspirin significantly decreased the size of atherosclerotic plaques in whole aortas and aortic roots.4.2 Aspirin increases the stability of atherosclerotic plaque in Apoe-/- miceAspirin at 20,50 mg/kg/day decreased the plaque vulnerable index.50 mg/kg/day aspirin was more effective than 20 mg/kg/day at maintaining the stability of vulnerable plaques.4.3 Aspirin increases phosphorylation of AP-2a in Apoe-/-- mice20-50 mg/kg/day aspirin, but not 5 mg/kg/day, remarkably increased AP-2a phosphorylation in vivo, supporting an important role of AP-2a in the protective effects of aspirin on atherosclerosis.4.4 Lentivirus-mediated RNA interfere of AP-2a abolishes the suppressive effects of aspirin on atherosclerotic plaque growth in Apoe-/- miceAP-2a shRNA treated mice had significantly higher lesion areas in the aorta and aortic arch than control shRNA treated mice. Aspirin significantly suppressed whole aortas and aortic arch lesion areas in Apoe-/- mice infected with control shRNA lentivirus, but had no significant suppression in Apoe-/-- mice infected withAP-2a shRNA lentivirus.4.5 Knockdown of AP-2a ablates the effects of aspirin on maintaining atherosclerotic plaque stability in Apoe-/- miceAspirin increased the plaque stability in Apoe-/- mice. Aspirin could not suppress plaque instability in the AP-2a shRNA treated mice. These data demonstrate that AP-2a is essential for atherosclerotic plaque stability induced by aspirin.4.6 Aspirin increases AP-2a DNA-binding activity in VSMCsThe serine 219 phosphorylation of AP-2a was increased by aspirin in a dose-dependent manner. Aspirin increased AP-2a DNA-binding activity in nuclear extracts from both resting and TNFa-stimulated endothelial cells.4.7 Aspirin via AP-2a activation increases IkBa gene expression in VSMCsThe association between AP-2a activation and I?B? gene upregulation was tested by CHIP assay, indicating that there is an AP-2a binding site in the promoter/enhancer region of I?B? gene. TNFa dramatically decreased the IkBa protein level, while co-incubation of aspirin reversed TNFa-induced reduction of IkBa protein levels. Importantly, aspirin also increased IkBa mRNA in TNFa-treated cells. Aspirin increased the level of pS219-AP-2a in cells infected with plain vector or WT-AP-2a, but not in cells with overexpression of S219A-AP-2a mutant. Compared to plain vector, WT-AP-2a further enhanced aspirin-stimulated IkBa protein expression in cells. However, S219A-AP-2a abolished the effects of aspirin on IkBa protein expression in cells. Reversely, ROS production was not suppressed by aspirin in cells expressing S219A AP-2a, indicating that activated AP-2a is required for aspirin's inhibitory effect on oxidative stress.4.8 Aspirin via AP-2a enhances IkBa protein and reduces oxidative stress in Apoe-/- miceAspirin dramatically increased IkBa protein level, inhibited NF-kB DNA-binding activity, and reduced the levels of p47, Nox4 and 4-HNE in carotid arteries from Apoe-/-- mice infected with control shRNA. The effects of aspirin on suppression of oxidative stress were further confirmed by detecting the levels of F2-isoprostanes.4.9 Aspirin increases AP-2a phosphorylation and IkBa protein expression in humansThe levels of pAP-2a and IkBa protein in leucocytes were much higher in patients taking aspirin than those non-aspirin controls. Due to probable interindividual differences, we also tested the levels of pAP-2a and IkBa protein in the same person. Similarly, the levels of pAP-2a and IkBa protein were increased after aspirin administration, compared to those before aspirin treatment.5 Conclusion(1) Aspirin activates AP-2a to upregulate IkBa gene expression.(2) Aspirin alleviates atherosclerotic plaque growth and instability via activation of AP-2a expression up-regulated genes IkBa...