The Roles Of Nox4in TGF-β-induced Endothelial Cell Apoptosis And Phenotypic Switch And The Underlying Mechanisms

BackgroundTransforming growth factor-β (TGF-β) has pleiotropic effects in regulating cardiovascular physiology and disease, while one of the major targets of TGF-P in the vasculature is endothelial cells. Disruption of TGF-P signaling in endothelial cells results in impaired vascular development in the embryo, and TGF-P also has pivotal roles in postnatal angiogenesis. In addition, TGF-β has been implicated in modulating endothelial cell proliferation, apoptosis, permeability and morphogenesis. There is evidence that TGF-P concentration in the plasma is elevated in patients with risk factors of cardiovascular disease, including obesity and diabetes. Moreover, an increased level of circulating TGF-P was found in women with preeclampsia. In atherosclerosis-prone apolipoprotein(E)-deficient mice, systemic elevation of TGF-β expression induced endothelial oxidative stress and dysfunction. Remarkably, the biological effects of TGF-P in endothelial cells are often dichotomous (either protective or detrimental), depending on the cellular context and the type of endothelial cells involved.In endothelial cells, TGF-β-induced effects are mainly mediated by the membrane receptors activin receptor-like kinase (ALK)1and ALK5. Stimulation of the ALK1receptor phosphorylates Smadl/5/8, while stimulation of ALK5triggers phosphorylation of Smad2/3. These activated Smad proteins then work together with Smad4as a transcriptional activating complex to regulate the expression of various target genes, while activation of ALK1and ALK5may induce distinct cellular effects in endothelium. In addition to these canonical signaling pathways, emerging evidence suggests that NADPH oxidase-dependent redox mechanisms may also be involved in mediating the biological actions of TGF-β. In particular, TGF-P specifically upregulates expression of the Nox4type of NADPH oxidase in a variety of cells (including vascular cells). More importantly, these studies have demonstrated that blockade of Nox4expression or function inhibits TGF-β-induced effects on multiple cell functions, indicating a pivotal role of Nox4in TGF-β signaling.Several lines of evidence have shown that TGF-β can trigger an apoptotic response in different types of endothelial cells. However, the signaling mechanisms underlying this action of TGF-β are poorly understood. Lu et al. demonstrated that TGF-β-induced apoptosis in pulmonary microvascular endothelial cells was dependent on the ALK5-Smad2pathway and subsequent downregulation of the antiapoptotic genes Bcl-2and cFLIP. On the other hand, several studies have pointed to a critical role of activation of the p38mitogen-activated protein kinase (MAPK) in mediating TGF-β-induced endothelial apoptosis. Nevertheless, so far there is little information about whether TGF-β-induced apoptosis in endothelial cells involves redox-dependent signaling mechanisms. In light of some recent results showing that increased reactive oxygen species (ROS) production may have a prominent role in promoting cell apoptosis in response to TGF-β, we hypothesize that Nox4-dependent redox regulation may mediate TGF-P-induced endothelial cell apoptosis.Objectives1. To investigate the effect of TGF-β on endothelial apoptosis2. To clarify whether Nox4and redox signaling mediate TGF-β-induced endothelial apoptosis3. To explore the mechanisms of TGF-β-induced endothelial apoptosis and role of MAPKsMaterials and Methods1. Cell cultureHUVECs and immortalized HMVECs were purchased from the American Type Culture Collection (ATCC). Cells were cultured in complete endothelial cell medium (ECM) containing5%fetal bovine serum in a humidified incubator with5%CO2at37℃. HUVECs used for the experiments were between passages3and6.2. Caspase3/7activity assayCells seeded in96-well plates were incubated with the Caspase-Glo3/7substrate reagent. The samples were transferred to a white-walled plate and the luminescence signal was measured in a Varioskan Flash plate reader.3. Western blot analysisCells were homogenized in lysis buffer after stimulation, then protein samples were separated by SDS-PAGE and electro-transferred to nitrocellulose membranes. The membrane was blocked with5%nonfat milk and incubated with specific primary antibodies. Secondary HRP-conjugated antibodies were developed with ECL Prime reagents and detected with a LAS-4000luminescent image analyzer.4. TUNEL labelingTUNEL was performed using ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit (Merck Millipore) following the manufacturer’s protocol. The number of TUNEL-positive cells were counted and averaged across10random fields from4independent experiments each.5. ROS measurementIntracellular ROS was measured with DCFH-DAnfluorescence. Cells were incubated with DCFH-DA at37℃for20min. After staining, cells were detected with a laser-scanning confocal microscope or transferred to a96-well white-walled plate to detect the fluorescent signal with a Varioskan Flash plate reader.6. Measurement of mitochondrial membrane potential (△Ψm)The fluorescent probe JC-1was used to determine changes in△Ψm. Cells were stained with JC-1and analyzed by either flow cytometry or confocal microscopy. Decreased△Ψm is reflected by the decrease in red fluorescence (dye accumulated in mitochondria).7. Nox4interferenceLentiviral vectors carrying a shRNA targeting human Nox4were purchased from GenePharma (Shanghai, China). The targeting sequence for Nox4was5’GCTGTATATTGATGGTCCTTT3’.A scrambled sequence of5’GGTGTCTTCGAATTTATGTCT3’was used as control. Experiments were performed48hr after transfection8. Real-time PCRTotal RNA was extracted with TRIzol reagent and reverse transcripted to cDNA. Real-time PCR was performed using predesigned Taqman probe-primer sets and18S was used as house keeping gene.9. ImmunofluorescenceCells cultured on Lab-Tek chamber slides were fixed and then incubated with primary antibodies and Alexa Fluor594-conjugated secondary antibodies. After counter staining with DAPI, cells were photographed using a confocal microscope.10. Statistical analysisData are presented as mean±standard error of the mean (SEM). Data analysis was performed with unpaired t-test or one-way analysis of variance (ANOVA) using SPSS18.0software. P<0.05was considered as statistically significant.Results1. TGF-P induces a moderate apoptotic response in human endothelial cellsWe found that TGF-β significantly increased caspase3/7activity and triggered caspase3cleavage from lng/ml to20ng/ml (Figure1B). We further demonstrated that the effects of TGF-β on apoptosis were time-dependent, with the strongest effects being observed at24and48hr. To confirm our findings in HUVECs, we treated HMVECs with TGF-β and showed that TGF-P induced similar apoptotic reactions in a dose-and time-dependent manner.2. TGF-β-induced apoptosis is dependent on ALK5Treatment with SB431542abolished the apoptotic response induced by TGF-p as indicated by caspase3/7activation and caspase3cleavage. Moreover, we showed that SB431542also prevented the collapse of mitochondrial membrane potential (△Ψm) in response to TGF-P as measured with JC-1staining. Moreover, we confirmed that SB431542had no effects on staurosporine-induced apoptosis.3. ROS mediates TGF-p-induced apoptosisTGF-P treatment enhanced intracellular ROS production in HUVECs, and this effect could be blocked by SB431542. We preincubated the cells with antioxidant compounds NAC (N-acetyl-L-cysteine) or EUK-134and showed that both NAC and EUK-134abrogated TGF-β-induced caspase3/7activation.4. TGF-P increases the expression of Nox4in mRNA and protein levelWe found that Nox4expression was increased by TGF-P in a time-and concentration-dependent manner as measured by real-time PCR and western blot, which was blocked by SB431542. Immunofluorescence experiments confirmed that TGF-β increased the abundance of Nox4protein, both in the nuclei and in the cytosol, and this effect was also blocked by SB431542.5. Nox4mediates TGF-β-induced endothelial apoptosisIt was revealed that Nox4gene silencing blunted TGF-β-induced apoptosis, as determined by caspase3/7activity. To further confirm the results, we treated the cells with the pharmacological Nox inhibitor VAS2870, and showed that VAS2870also blocked caspase3/7activation, caspase3cleavage and disruption of△Ψm induced by TGF-p.6. Role of MAPKs in TGF-β-induced endothelial apoptosis TGF-P treatment increased phosphorylation of p38from12hr to48hr as compared to untreated cells. In contrast, phosphorylation of JNK was only transiently increased around12hr. We treated the cells with specific p38or JNK kinase inhibitors and demonstrated that inhibition of the p38pathway with SB202190blocked the proapoptotic effects of TGF-β, whereas the JNK Inhibitor II had no significant effects. We further confirmed these results by knocking down p38and JNK expression with specific siRNAs.7. TGF-β activates MAPKs in a redox-sensitive mannerWe found that NAC completely blocked the effect of TGF-p on p38phosphorylation. However, NAC per se somehow increased the basal level of JNK phosphorylation, while the effect of TGF-P on JNK phosphorylation in the presence of NAC was not significant, indicating that activation of both p38and JNK were redox sensitive. Moreover, we showed that inhibition of the Nox4function with VAS2870diminished TGF-β-induced p38phosphorylation. In contrast to MAPKs, TGF-P had no effects on Akt phosphorylation either under the basal condition or in the presence of NAC or VAS2870.Conclusions1. TGF-P induces endothelial cell apoptosis through ALK5receptor2. Nox4and redox signaling mediate TGF-β-induced endothelial apoptosis3. TGF-P induces endothelial apoptosis through p38MAPK in a redox-dependent manner. BackgroundROS are molecules existing widely in biological systems, and accumulating evidence has identified that NADPH oxidase is the major source of ROS generation in vasculature. The catalytic subunit of the NADPH oxidase family consists of seven members, namely Nox1-5and Duox1and2. Noxl, Nox2, Nox4and Nox5are four main members in vasculature with Nox4and Nox2predominant in endothelial cells. The enzymes transfer electrons from NADPH to molecular oxygen, producing ROS consisting of locally effective superoxide and/or the relatively long-lasting and membrane-diffusible ROS hydrogen peroxide (H2O2). Nox4differs from other NADPH oxidase isoforms by its abundant expression in vascular tissues and constitutive activity.Nox4type NADPH oxidase has multiple regulatory functions including apoptosis, cell growth, differentiation, angiogenesis and cytoskeletal remodeling. Nox4expression is increased in many cardiovascular diseases, such as atherosclerosis, hypertension, restenosis, vascular aging and fibrosis. Recently, more and more studies have revealed its controversial functions, and many researches indicate Nox4as a protective factor in cardiovascular systems since the model of gene-modified mice with Nox4overexpression successfully established.Moreover, our previous studies in endothelial cells suggest that increased Nox4expression may enhance cell proliferation (presumably a prosurvival effect) via activating the ERK1/2MAPK pathway. In the present study, therefore, we also attempted to reconcile these seemingly paradoxical effects of Nox4in modulating endothelial cell apoptosis and survival.Protein tyrosine phosphatases (PTPs) are sensitive to ROS and can be oxidized to lose their activities. PTPs negatively regulate receptor tyrosine kinases (RTKs), including receptors of some growth factors such as EGF, IGF-1, PDGF and VEGF. PTP1B, belonging to the classical PTPs, is the first isolated PTP in its pure form and it is a treatment target for type2diabetes, obesity and cancer.PTEN is a hallmark of cancer suppressor which is commonly found mutant in most human tumor cells. PTPs negatively regulate Akt signaling by dephosphorylating phosphatidylinositol (3,4,5)-trisphosphate (PIP3). In this part, we will explore whether PTPs and (or) Akt participate Nox4-induced anti-apoptotic effect.Objectives1. To explore role of Nox4overexpression in endothelial apoptosis2. To evaluate whether Akt or ERK1/2signaling pathway mediates the anti-apoptotic effect of Nox4in endothelial cells3. To investigate the mechanisms of Nox4-stimulated Akt activation and the role of PTPsMaterials and Methods1. Nox4overexpression by viral vectorsA cDNA clone of human wild type Nox4was purchased from Origene and subcloned into pLV.EX3d.P/neo-EF1A. Experiments were performed48hr after transfection with lentiviruses expressing human Nox4or eGFP (control). Adenoviruses expressing wild type human Nox4were gifts from Dr Goldstein.2. Caspase3/7activity assayCells seeded in96-well plates were incubated with the Caspase-Glo3/7substrate reagent. The samples were transferred to a white-walled plate and the luminescence signal was measured in a Varioskan Flash plate reader.3. Western blot analysisCells were homogenized in lysis buffer after stimulation, then protein samples were separated by SDS-PAGE and electro-transferred to nitrocellulose membranes. The membrane was blocked with5%nonfat milk and incubated with specific primary antibodies. Secondary HRP-conjugated antibodies were developed with ECL Prime reagents and detected with a LAS-4000luminescent image analyzer.4. ImmunofluorescenceCells cultured on Lab-Tek chamber slides were fixed and then incubated with primary antibodies and Alexa Fluor594-conjugated secondary antibodies. After counter staining with DAPI, cells were photographed using a confocal microscope.5. ImmunoprecipitationCell lysates were precleared and incubated with antibody and protein A or G agarose bead slurry. The beads were washed and protein samples were separated by SDS-PAGE and the following procedures were taken as western blot.6. PTP1B activity assayPTP1B activity was measured in immunoprecipitated PTP1B protein samples using a PTP colorimetric assay kit from Millipore according to the manufacturer’s instruction.7. Statistical analysisData are presented as mean±SEM. Data analysis was performed with unpaired t-test or one-way ANOVA using SPSS18.0software. P<0.05was considered as statistically significant.Results1. Nox4overexpression is protective against endothelial apoptosisWe demonstrated that lentivirus-mediated Nox4overexpression (vNox4) suppressed both of the basal level of and serum starvation-induced apoptosis in HUVECs. In addition, we showed that overexpression of Nox4(using adenovirus) also reduced the apoptosis induced by staurosporine. TGF-β failed to induce endothelial apoptosis following Nox4overexpression.2. vNox4inhibits endothelial apoptosis through Akt activationWe showed that phosphorylation of Akt was dose-dependently increased by vNox4treatment. However, vNox4had no significant effects on ERK1/2phosphorylation. Treatment with Akt Inhibitor ⅧIor wortmannin significantly attenuated the antiapoptotic effects of vNox4, whereas treatment with U0126produced no effects. We also confirmed that knocking down of Akt with siRNA partially blocked the inhibitory effects of vNox4on apoptosis.3. Subcellular distribution of Nox4between ectopic and endogenous Nox4We performed immunofluorescence in vNox4-treated cells and found that vNox4increased the Nox4protein level in both of the cytoplasm and nuclei, a pattern that was similar to that following TGF-β treatment.4. PTP1B inhibitor stimulates Akt activationWe demonstrated that treatment with PTP1B inhibitor, but not PTEN inhibitor, increased Akt phosphorylation in resting endothelial cells. This effect of PTP1B inhibition was comparable to that induced by vascular endothelial growth factor (VEGF), while VEGF did not further increase Akt phosphorylation in the presence of PTP1B inhibitor. In contrast, VEGF similarly induced Akt phosphorylation in the absence and presence of the PTEN inhibitor.5. vNox4suppresses PTP1B activity and enhances VEGFR activationWe showed that Nox4overexpression suppressed PTP1B activity, an effect that was abolished by the reducing agent DTT. Immunoprecipitation with anti-VEGFR2or anti-phospho-tyrosine followed by western blot analysis revealed that inhibition of PTP1B or overexpression of Nox4enhanced VEGFR2phosphorylation. Similar to the effects on Akt phosphorylation, VEGF only increased the basal level of VEGFR2phosphorylation, but had smaller effects on VEGFR2phosphorylation in the presence of vNox4or PTP1B inhibitor.Conclusions1. Ectopic Nox4overexpression protects against endothelial apoptosis2. Akt signaling mediates ectopic Nox4inhibition of endothelial apoptosis3. The inhibitor of PTP1B stimulates Akt activation4. Ectopic Nox4enhances VEGFR activation through suppressing PTP1B activity BackgroundCellular differentiation is not only an important progress in cardiovascular embryonic development but also found in adulthood to maintain the homeostasis of vasculatures. Misidentification of arterial or venous endothelial cell fate would cause drastic consequences of the circulatory system in the development and function. Despite arterial and venous disturbing would bring about deficiency and lethality in embryonic development, arteriovenous malformation (AVM) is one characteristic of hereditary hemorrhagic telangiectasia (HHT) and AVM in the brain is the mainly leading cause of intracranial hemorrhagic stroke, particularly in younger people.TGF-β signaling pathway is reported to play important roles in angiogenesis and mice deficient for components of TGF-β signaling display embryonic lethalities due to vascular defects. People have shown that lack of endoglin (an accessory receptor of TGF-β) or ALK1results in vascular pathologies resembling AVM related to HHT, which are accompanied by disturbance of arterial and venous specificities.Indirect evidence indicates that TGF-P signaling may have impacts on the specification of endothelial phenotypes. Specification of arterial or venous type of endothelium during development is under strict transcriptional control. In the cardiovascular system, EphrinB2expression is restricted to the arteries and its receptor EphB4is predominantly expressed in venous endothelial cells. This pair of ligand-receptor has been used as markers of arterial and venous endothelial cells respectively.It is thought that venous phenotype is the default state during endothelial differentiation, while activation of the Notch signaling pathway (which is downstream of vascular endothelial growth factor A and sonic hedgehog) is obligatory for arterial differentiation. The evolutionarily conserved Notch signaling pathway consists of four Notch receptors (Notch1-4) and five Notch ligands (Jagged1,2and DLL1,3,4) in mammals. Cell-bound ligand initiates Notch signaling and triggers y-secretase to cleave the transmembrane receptor. The Notch intracellular domain (NICD) is then released from the receptor and translocates into the nucleus in association with the DNA-binding protein CSL (RBP-Jκ/CBF1) and the coactivator Mastermind-like (MAML) to activate target genes transcription such as HES and HEY families.Interestingly, mounting evidence indicates that ROS-mediated signaling is an important regulator of stem or progenitor cell differentiation. However, little is known about the effects of ROS on arterial-venous specification of endothelial cells. Therefore, the aim of this part is to explore the potential involvement of TGF-β-induced redox regulation in changes of the arterial and venous phenotype specification of endothelial cells.Objectives1. To investigate the effect of TGF-β on expression of arterial and venous markers2. To study whether TGF-β influences Notch signaling pathway3. To explore role of redox signaling in TGF-β-inducedarterial phenotypic switchMaterials and Methods1. Real-time PCRTotal RNA was extracted with TRIzol reagent and reverse transcripted to cDNA. Real-time PCR was performed using predesigned Taqman probe-primer sets or SYBR Green method and GAPDH or18S was used as house keeping gene.2. Western blot analysisCells were homogenized in lysis buffer after stimulation, then protein samples were separated by SDS-PAGE and electro-transferred to nitrocellulose membranes. The membrane was blocked with5%nonfat milk and incubated with specific primary antibodies. Secondary HRP-conjugated antibodies were developed with ECL Prime reagents and detected with a LAS-4000luminescent image analyzer.3. ImmunofluorescenceCells cultured on Lab-Tek chamber slides were fixed and then incubated with primary antibodies and Alexa Fluor594-conjugated secondary antibodies. After counter staining with DAPI, cells were photographed using a confocal microscope.4. Nuclear and cytoplasmic protein extraction and western blotCells were harvested after treatment with TGF-β, nuclear and cytoplasmic protein was obtained using Nuclear and Cytoplasmic Protein Extraction Kit from Beyotime Company. Then western blot was performed to detect the nuclear translocation of NICD.5. Statistical analysisData are presented as mean±EM. Unpaired t-test or one-way ANOVA was performed to analyze data. p<0.05was considered as statistically significant.Results1. TGF-β stimulates expression of arterial markers in HUVECsTGF-β upregulated expression of the arterial marker EphrinB2, but had no effects on expression of the venous maker EphB4.We did not observe a significant change in the EphrinB2protein level.2. TGF-β activates Notch signaling pathwayTGF-β significantly increased the expression levels of Notch receptors (Notchl and Notch4) and ligands (Jaggedl and DLL4), and the Notch target gene (HEY1) in mRNA level. The increased expression of DLL4, Notchl and Jaggedl were also confirmed with western blot.3. TGF-β increases NICD production and nuclear translocationTGF-β treatment increased the amount of NICD, and stimulated nuclear translocation of NICD as detected with immunofluorescence and western blot of nuclear and cytoplasmic protein, indicating an enhanced Notch signaling.4. The effect of TGF-P on arterial switch is cell-specificIn HMVECs, we did not observe any significant effects of TGF-β on EphrinB2, EphB4, Notchl, Notch4, Jagged1or HEY1, indicating that the effects of TGF-β on expression of the arterial markers were cell type-specific.5. TGF-β-induced arterial marker expression is redox dependentWe demonstrated that in the presence of NAC, the effects of TGF-P on arterial marker expression were all diminished. Consistently, we found that application of exogenous H2O2mimicked the effects of TGF-β on expression of the arterial markers. Importantly, we demonstrated that TGF-β-induced effects on expression of Notchl, Jaggedl, HEY1and EphrinB2were diminished in cells pre-treated with the lentivirus expressing Nox4shRNA.Conclusions1. TGF-β induces endothelial cell arterial phenotypic switch in a cell-specific manner 2. TGF-P activates Notch signaling pathway in HUVECs3. Redox signaling mediates TGF-β-induced arterial phenotypic switch of HUVECs...