Association Studies Of Interleukin12B Gene Polymorphism And Early-onset Coronary Atherosclerosis Heart Disease

BackgroundCoronary atherosclerotic heart disease (CAD), as a common cardiological condition, has imposed great threat on human health. Cardiovascular and cerebrovascular diseases caused by atherosclerosis include coronary heart disease and stroke, have become the major causes of mortality and disability in modern society. Early-onset coronary heart disease, as a special type of CAD, occurs in males below55years old and females below65years old. Recent domestic and foreign researches have showed that the incidence of early-onset CAD is on the rise, especially among middle-aged people. Latest statistics have revealed that the mortality rate of CAD has declined in developed countries, but is rising startlingly in developing countries, including China. WHO has estimated that the epidemic peak of CAD will arrive around2020in China. Therefore, CAD control remains a challenging task.Many genes are associated with early-onset CAD. Current studies suggest that inflammation is an independent risk factor. As a result, genes related both to early-onset CAD and inflammation have become the focus in recent years. In-depth study of these genes will undoubtedly provide new insights into the prevention and treatment of early-onset CAD. Atherosclerosis disease is caused by both genetic and environmental factors with a complex mode of inheritance. Through the analysis of positional cloning and candidate gene association, certain genes playing important roles in the process of atherosclerosis have been identified.Of the many pathological theories of CAD, including lipid infiltration theory, neuroendocrine theory, theory of homocysteine metabolism and inflammatory damage of endangium, the inflammatory cytokines have been identified as a direct pathogenic factor. Research on the association of inflammatory cytokines and CAD has recently attracted great attention. Since CAD does not follow the Mendel genetic model, its genetic basis might represent the accumulation of more than one DNA mutation. To understand genetic mode of complex diseases, single nucleotide polymorphism has been applied to detect different gene loci in the case group and control group. Polymorphism of multi-site single nucleotide makes gene expression and translation diversified. Comparison of accumulated gene frequency in the case group and control group comparison has been widely applied in the research of many complex diseases.As interaction of genetic factors and environmental factors is the common feature of diseases, overseas researchers have studied the genetic polymorphism of IL-12B in pathogenesis of vascular lesions. Due to the heterogeneity of races and geographical and dietary differences, researched have produced different results. Compared with the gene mutation, single nucleotide polymorphism is common in biological individuals. Different genotypes may have different impact on the phenotype of diseases, and this provides us with a new way to investigate the etiology of early-onset CAD.IL-12B, one of the inflammatory cytokines, is involved in the occurrence and progression of CAD. It is located on chromosome5q31-33, regulating the activation of macrophages and generation of peptides p40secreted by B cell secretion. IL-12B anti-inflammatory mechanism mainly includes:cytotoxic effect through NKT cells, CD4+T cells and NK cells; indirect removal of tuberculosis bacili mediated by tumor necrosis factor; production of endogenous IFN-y by NK cells; direct regulation of phagocyte function and activation of the complement system.ObjectiveThis study analyzed the differences of IL-12B gene polymorphism between the Chinese Han probands early-onset CAD cases with their parents, investigated the association of gene polymorphism and Chinese Han early-onset CAD probands, explored the role of gene polymorphism in the genetic mechanism, in order to provide theoretical basis for the etiological and pharmaceutical research, and the gene diagnosis and treatment of the disease.MethodsPatients with early-onset CAD and their families were enrolled in the study. Inclusion criteria:Han nationality, male<55years old and female<65years old; percutaneous coronary angiography confirmed the stenosis degree of at least one coronary artery>50%. Exclusive criteria:non-Han nationality; with history of malignant tumor; with serious liver and kidney dysfunction; with confirmed diseases of the hematological system; with confirmed inflammatory diseases; with confirmed hyperthyroidism and thyroid disease; with other conditions such as pulmonary embolism, cardiomyopathy, aortic aneurysm, heart valve disease, congestive heart failure, and so on. The biological parents of the patients were included in the control group with the inclusive criteria:>50years old; Han nationality; with no serious physical or brain disease; with no early-onset CAD; with no substance abuse or dependence; with informed consent.5ml peripheral venous blood was sampled from the objects, which was then put in100microliter0.5mol/1EDTA (PH8.0). After being placed for15～30minutes with room temperature, the blood sample was centrifuged for15minutes with4000rmp. Blood cells were then separated and placed in-20℃freezer. Then the blood cells were thawed at room temperature. Take100μl venous blood was taken from the centrifuge tube and DNA was extracted by Chelex100method. The extracted DNA was identified by agarose gel electrophoresis. Polymerase chain reaction (PCR):0.5μl DNA genome dissolved in1ml TE (PH8.0) was diluted10times to be5μl as a template. The overall reaction system was25μl. Four SNP loci were referred to, and Primer Premier5.0was taken as design primers. The upstream primer of rs15677380was5’TTTGTCATCCCGTCTCCTT C3’and the downstream primer was5’CAACAAAATATCCTGTGT TAGGTAG A3’; the upstream primer of rs1203527793was5’CAAAATGAAAGGT GGGA GGA3’and the downstream primer was5’GGGGCTAAGTAGGCTGAAA AA3’; the upstream primer of rsl4050306was5’CTGGCACTATCCCCCAAGTA3’and the downstream primer was5’TTCAGTAGTGG CAGCAGTGG3’; the upstream primer of rs13726393was5’CATGACCTATGATTAATCTCTTCCA3’and downstream primer was5’CCTGTGAAGAAAAGGCCA TA3’. The amplification reaction system was25μl reaction system containing12μl2×Tap PCR MasterMix (components:0.1U Tap Polymerase/μl,500μM dNTP each,20μM Tris-HCl (pH8.3),100μM KC1,3mM MgC12);2μl upstream and downstream primers respectively;4μl DNA template. Double distilled water was added to make the total volume of25μl. PCR mixture was pretreated at95"C for5min, then through35cycle reaction, and then extended10mim. The enzyme system was then classified.20μl enzyme system included10μl PCR amplification products,2μl10xbuffer,0.2μl incision enzyme (rs15677380as Ddel, rs1203527793as SphI, rs14050306as Scr F I, rs13726393as Hpa I). Double distilled water was added to make the total volume20μl. Enzyme product was placed at37℃in the incubator for4h and then separated with2.5%agarose gel electrophoresis. Polypropylene amide gel electrophoresis and silver staining was used for rs1203527793. The automatic gel imaging analysis system was used to observe and photo the enzyme profiling genotype. The amplification was done in Perkin reaction-Elmer9600.Fasting insulin (FINS) and c-peptide, urine trace albumin creatinine ratio were measured using radiation immunity analysis; HbA1C was determined with high pressure liquid affinity chromatography method; total cholesterol (TCHO), triglycerides (TG), blood uric acid (UA), fasting blood glucose (FBG),2h post prandial blood glucose (PBG), fasting insulin (FINS), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), and hepatorenal function were detected with fully automatic biochemical analyzer. Blood cells were analyzed with routine examination, urine routines were analyzed with urine analyzer. Operations were in strict accordance with the specifications. Insulin resistance index was defined as the fasting plasma insulin (mIU/L)×fasting blood glucose (mmol/L)/22.5.Statistical methods:The measurement data were presented with mean±standard deviation. Measurement data of different genders were compared with independent-samples t test. Measurement data of same locus genotype were compared with variance analysis. Differences of genotype and gene frequency distribution between different genders were tested with chi-square test. All statistical analyses were conducted with SPSS17.0software.The rs15677380, rs1203527793, rs14050306, rsl3726393gene genotypes and alleles of patients and their core families were tested with R Language Genetics Software Package for Hardy Weinberg equilibrium. Linkage disequilibrium of loci was calculated with R Language Genetics Software Package. The data were tested with MCPDT Software Package, and the association of gene and disease was analyzed with FBAT1.7.3.A11tests took P<0.05as the significance threshold.Results(1) A total of348cases were enrolled in the study group, including200male and148female, average age being44.23±4.711.(2) Hardy Weinberg equilibrium test:On the rsl3726393locus, the control group:x2=65.28, P<0.001; the study group:χ2=50.84, P<0.001. On the rsl5677380locus, the control group:χ2=32.60, P<0.001; the study group:χ2=1.52, P=0.233. On the rs14050306locus, the control group:χ2=26.59, P<0.001; the study group:χ2=61.50, P<0.001. In rs1203527793locus the control group, and rs15677380locus in the study group were aligned with Hardy Weinberg equilibrium. (3) The SNP loci of rs13726393, rs15677380, rs14050306and rs1203527793had A and G dimorphism which could be identified by Hpa I endonuclease, DdeI enzyme Scr FI, and SphI enzyme, respectively.(4) The different distributions of genotypes at4SNP loci and alleles between different genders were compared with chi-square test, which showed there was no significant difference in rs13726393and rs15677380SNP loci, and there were differences at other loci. At the rs13726393loci, the genotype frequency of both genders was χ2=0.96, P=0.627, and allele frequency was χ2=0.29,P=0.591. At the rs15677380loci, the genotype frequency of both genders was χ2=43.60, P<0.001, and allele frequency distribution was χ2=0.06, P=0.806. At the rs14050306loci, the genotype frequency of both genders was χ2=24.07, P<0.001, and allele frequency distribution was χ2=26.44, P<0.001. At the rs1203527793loci, the genotype frequency of both genders was χ2=25.70, P<0.001, and allele frequency distribution was χ2=11.45, P=0.001.(5) The loci of rs15677380, rs1203527793, rs14050306, rs13726393on the chromosome were6065277,61120383,64110562, and6610754, respectively. The analysis results of linkage disequilibrium of rs15677380-rs1203527793, rs15677380-rs14050306, rs15677380-rs13726393, rs1203527793-rs14050306, rs14050306-rs13726393were:χ2=47.57, P<0.001;χ2=1.73, P=0.189;χ2=3.49, P=0.060;χ2=6.13,P=0.013;χ2=1.30,P=0.254;χ2=0.22,P=0.642.(6) There was association between the rsl3726393alleles and early-onset CAD (P=0.002), allele A was the risk factor (Z=3.05), and allele G was the protection factors (Z=-3.05). There was no association between the rs14050306alleles and early-onset CAD (P=0.002), allele A was the risk factor (Z=2.94), and allele G was the protection factors (Z=-2.94). There was association between the rs15677380alleles and early-onset CAD (P<0.001), allele A was the risk factor (Z=-8.80), and allele G was the protection factors (Z=8.80). There was no association between the rs1203527793alleles and early-onset CAD (P=0.171).Haplotype relative risk analysis showed:There was link between AG, GG, GA, AA of rs14050306-rs13726393and early-onset CAD by (P<0.001). There was link between AG,AA,GG,GA of rs15677380-rs1405036and early-onset CAD (P<0.001); There was link between GG,GA,AA,GG of rs15677380-rs13726393and early-onset CAD (P<0.001). There was linked between GA and AG of rs1203527793-rs1405036and early-onset CAD (P=0.002,0.025). There was link between GG and AA of rsl2035277933-rs13726393and early-onset CAD (P=0.006,0.009). There was link between GA and GG of rs1405036-rsl3726393and early-onset CAD (P<0.001).There was link between all haplotypes of rs15677380-rs1203527793-rs14050306and early-onset CAD (P<0.05). There was link between GGT, GAG and AGA of rs1203527793-rsl4050306-rs13726393and early-onset CAD (P<0.001). There was link between GAGG, GAAA, GGAA, GGGA, AAGA, AAAG and AGGG of the rsl5677380rs1203527793-rs14050306-rsl3726393and early-onset CAD (P<0.001). The other haplotypes had no correlation with early-onset CAD (P>0.05).(7) Analysis of IL-12B genotypes type and coronary artery stenosis rate, ejection fraction, C-reactive protein, the adiponectin showed no statistically significant differences except for the adiponectin (F=3.64, P=0.027).Conclusions(1) The results of IL-2B genotype by enzyme segmentation in Chinese Han population are consistent with foreign reports, but their polymorphism are higher than foreign reports.(2) There is associated between the rs13726393, rs14050306, rs15677380alleles and early-onset CAD.(3) There is association between the SNP loci of IL-12B gene haplotype and early-onset CAD.