Study On The Expression Analysis Of MicroRNAs In Peripheral Blood Monoculear Cells Of Non-Segmental Vltiligo And On The Action Mechanisms Of MiR-3940-5P In Human Cutaneous T Cell Line

OBJECTIVEThis study sought to detect the different miRNA expression pattern in the peripheral blood mononuclear cells (PBMCs) of patients with non-segmental vitiligo (NSV) and to screen the differentially expressed miRNAs compared with healthy individuals. The miRNA expression profile in the PBMCs of patients with NSV was analyzed using miRCURY LNATM microRNA Array Chip. The differentially expressed miRNAs were validated by real-time quantitative PCR. The peripheral blood monocytes isolated from patients were cultured with or without thymosin α1 (Tal) and morphological changes of cells were observed, while miRNAs were extracted to detect the direct effect on the expression changes of screened miRNAs after Tal treatment. Understanding how Tal regulates gene expression at the level of miRNAs will likely identify the mechanism of Tal injection as specific drug therapies.Target search were conducted and interleukin 2 receptor, gamma (IL-2RG) were selected as one of the target genes among the predicted targets of hsa-miR-3940-5p in the target gene prediction database miRDB and Targetscan. Lentiviral vector hsa-miR-3940-5p inhibition were conducted by lentivirus transfection technology to simulate the similar expression patterns in the lymphocytes of vitiligo patients and HuT78 cells were selected as lentiviral vector-infected cells which are derived from human cutaneous T-cell lymphoma sezary syndrome cell lines to further study the targeting regulation of miR-3940-5p on vitiligo immune related genes, so as to investigate their action mechanism of differentially expressed miRNAs and Tal in non-segmental vitiligo and to provide the further evidence that miRNAs may serve as novel drug targets for vitiligo therapeutic evaluation.METHODSIn the first part:Fresh peripheral venous blood was extracted from five patients diagnosed with non-segmental vitiligo in progression using standard clinical diagnostic criteria without systematic immune therapy for at least one month and five age-and gender-matched healthy individuals were enrolled. Patients with segmental and localized types of vitiligo were excluded from participation. The white patch area was greater than 3% of the body surface area (BSA). Peripheral blood mononuclear cells were isolated from anticoagulated venous blood and miRNAs in the PBMCs were extracted. After miRNAs extraction from the 10 samples, expression profiling of PBMCs in non-segmental vitiligo and healthy individuals was analysed using the 7th generation miRCURYTM LNA microRNA Array chip hybridization (v.18.0) (Exiqon). Hierarchical clustering was performed using MEV software (v4.6, TIGR) to show distinguishable miRNA expression profiling among samples. Fresh peripheral venous blood was collected from 32 patients diagnosed with non-segmental vitiligo in progression and 18 age-and gender-matched healthy individuals were enrolled and total RNA in the PBMCs were extracted and stem-loop RT primer-based approach was used for cDNA synthesis. The differentially expressed miRNA were validated by real-time quantitative polymerase chain reaction. The relationship was analyzed between the expression of miRNAs by the LNA Array and by RT-qPCR technology by Pearson’s correlation analysis. The peripheral blood monocytes isolated from patients with non-segmental vitiligo were cultured and different concentrations of thymosin alpha 1 were added to the cell suspension. After 72h, the cells were collected by centrifugation and miRNAs were extracted for RT-qPCR analysis to detect the relative expression levels of screened miRNAs and to analyse the direct effect on the expression changes of screened miRNAs after Tal treatment.In the second part:Bioinformatics database were conducted to predict and screen the vitiligo immune related gene interleukin 2 receptor, gamma (IL-2RG) as one of the target genes among the predicted targets of hsa-miR-3940-5p in miRDB. Lentiviral vector miR-3940-5p inhibition were conducted by lentivirus transfection technology and the viral suspension was infected to human cutaneous T cell lines HuT78 cells for 24h, meanwhile the lentivirus negative control group were established. The expression of miR-3940-5p was downregulated using predesigned antisense RNA sequence (CAGAGCCCGCCCCAACCCAC) competitive binding to pre-miR-3940-5p and cloned into the GV159 vector, H1-MCS-CMV-EGFP. Three or four days later the rate of GFP+ cells were observed and the celluar precipitation were harvested. The contents of IL-2RG in the lymphocyte supernatant were detected by ELISA and the expression level of IL-2RG protein were detected by Western Blot techniques in cultured HuT78 cells to to analyze the role of miRNA-3940-5p low expression in the regulation of target gene IL-2R Gamma.RESULTS1. Of the miRNA expression profile, four miRNAs that were significantly differentially expressed in the peripheral blood mononuclear cells from non-segmental vitiligo patients (n=5) compared with healthy individuals (n=5) using a high-throughput miRNA LNA Array platform that was able to assess the expression of almost 3000 human miRNAs and viral miRNAs. Of which miR-224-3p, miR-2682-3p, miR-4712-3p were upregulated and miR-3940-5p was downregulated relative to healthy controls (p<0.05).2. Stem-loop reverse transcription followed by a SYBR Green PCR technology was applied to analyze the expression levels of the four miRNAs in a larger patient population and the results were found that the expression levels of miR-224-3p, miR-4712-3p were upregulated and miR-3940-5p was downregulated in the peripheral blood mononuclear cells of non-segmental vitiligo patients which had significant statistical difference (p<0.05). The results were consistent with the microarray data. This analysis showed that the expression of four miRNAs determined by LNA Array technology was highly positively correlated with the RT-qPCR results. The fold change of three miRNAs was highly correlated (r=1.000, p=0.005) between two methods. But there was no significant statistical difference in the upregulated expression level of miR-2682-3p compared with healthy controls as detected by PCR (p>0.05).3. Under the inverted phase contrast microscope scattered, suspended distribution, translucent, round cells were observed from cultured peripheral blood mononuclear cells in patients with non-segmental vitiligo. Significant increase in the number of cells and aggregation after adding different concentrations of thymosin alpha 1 (50、100ug/ml) to the cell suspension compared with the blank control group(p<0.05).After treatment for 72h, the expression levels of four selected miRNAs were examined by PCR and the levels of miR-224-3p, miR-2682-3p, and miR-4712-3p in cultured PBMC were lower and miR-3940-5p was higher in the presence of Tal compared to the groups without Tal, but there was no statistical significance between the two concentrations (p>0.05).4. In vitro experiments showed that compared with the slow virus negative control HuT78 cells, the transfected objective gene miR-3940-5p ddwnregulated expression group could promote the proliferation of T cells. The contents of IL-2RG in the lymphocyte supernatant were elevated and the expression levels of IL-2RG protein were upregulated in cultured HuT78 cells compared with negative controls (p <0.05).CONCLUSIONS1. Our study first conducted a comprehensive analysis of the miRNA expression profiles in the global immune cells in blood circulation from non-segmental vitiligo patients and healthy controls using a high-throughput miRNA array platform that was able to assess the expression of almost 3000 human miRNAs and viral miRNAs and identified four differentially expressed miRNAs from patients with non-segmental vitiligo, including one downregulated miRNA and three upregulated miRNAs, which suggested that the four miRNAs may be associated with the action mechanism of immune imbalance of non-segmental vitiligo.2. To confirm the miRNA array expression findings, real time fluorescence quantitative PCR assay was carried out to verify the expression level of the four miRNAs and found that the results were consistent with the microarray data. The extraordinary stability of miRNAs through PCR technology make miRNAs attractive candidates for biological markers for the early diagnosis of disease.3. As a modulator of immune response, the common clinical immune modulator thymosin al changed the miRNA expression profile of the cultured peripheral blood mononuclear cells in patients with vitiligo as demonstrated by growth state of cultured cells and the miRNA expression level in Tal treatment tests. The results suggested that thymosin al play an important role by modulating the immune response via miRNAs and may serve as the novel targets for vitiligo treatment and efficacy. Understanding how Tal regulates gene expression at the level of miRNAs will likely identify the mechanism of Tα1 injection as specific drug therapies.4. miRNA-3940-5p is expressed in the human skin lymphoma cell line. Lentiviral vector-hsa-miR-3940-5p-inhibition can be transfected into the human cutaneous T lymphoma cell line HuT78 cells.5. MiR-3940-5p play a role by negative regulation of the cytokine receptor IL-2R Gamma gene, suggesting that miR-3940-5p may serve as a potential therapeutic target in the treatment of vitiligo.