| Objective1. To construct the RNAi-SCIN lentivirus vectors and pEGFP-3FLAG-SCIN overexpressing vectors2. To study the relation between liver metastasis and expression of SCIN gene in colorectal cancer.3. To search new target of therapy in colorectal cancer.Methods1. We screened differentially expressed gene in colon cancer patients with and without liver metastasis by gene-chip, and verified its expression by real-time PCR. Both gene-chip technology and RT-PCR results showed that SCIN gene is the most differentially expressed gene between these two groups.2. Four siRNA sequences, optimally suitable in theory, are selected and screened. These sequences are specific to SCIN gene. DNA fragment of shRNA framework is synthesized from siRNA sequences. Both ends of the fragment will contain sticky ends of enzyme cutting sites, used to connect to RNA interference lentivirus vector. The products were transferred to bacterium competent cells. The clones will be examined with PCR. In sequence comparison, successively constructed positive clones contain the RNAi-SCIN lentivirus vector, and will transfect the virus packaging cell lines293T.3. SCIN gene is fished from plasmids containing SCIN gene or cDNA library via PCR. At the next step, SCIN gene and intended vectors each undergo enzyme cutting separately. These products are then collected from electrophoresis and are processed by directional connection or exchange before transfecting Escherichia coli afterwards. For the transfected clones with signs of growth, PCR test is first given. If the test result is positive, the clones are then sequencing and comparative analysis. The result of correct comparison indicates successfully constructed SCIN gene overexpression vector construct. 4. Intended cell line cultures will be infected with the prepared viral vectors.48 to 72 hours later, both real time PCR and western blot tests will be employed to measure the efficiency of knock down of SCIN at the level of mRNA and protein products. The performance of gene silencing at 70% is considered "effective".5. The effective target will be used as shuttling vectors to pack a large amount of virus. The subsequently harvested virus will be purified, concentrated, and measured for the titer. a large amount of virus with high titers will be introduced for massively infection of normal cell cultures. At the end, functional tests will be performed on the infected cultures.6. Packaged enveloped lentivirus will infect human colorectal cancer cell lines, SW480 and DLD-1. qPCR and western blot will determine if SCIN expression is under prominent inhibition. The infected cell cultures will undergo both MTT and Transwell function tests.Results1. After transferring E. Coli with vectors containing Vsh RNA,5 clones are randomly picked for PCR test. For positive clones carrying Vsh RNA insert, the PCR fragment will consist of 343bps. On the other hand, clones without vectors, the PCR fragment will be of 306 bps. VshRNA insert consists of 79 Bps, which is consistent with theoretically predicted length of interference sequence.2. The result of the DNA test on 4 pair virus vectors with various sequence confirm that PSCSI1762-1, PSCSI1762-2, PSCSI1763, PSCSI1764 and PSCSI1765 vectors all contain a sequence identical to siRNA-SCIN framework, demonstrating synthesized dsDNA fragment successfully installed in the RNAi-SCIN lentivirus vectors.3. The SCIN gene fragment obtained in PCR amplification with subsequent Xho I/Kpn I enzyme cutting in electrophoresis strip is 1412bps long. This value is consistent with our theoretical value, meaning the actual SCIN fragment is obtained successfully. The PCR product acquired after transforming Escherichia coli with eukaryotic vectors containing previous PCR-enzyme cut fragment is 740bps long. In the following step, vector acquired positive clones is sequenced. In the result, the recombinant SCIN expressing vector is consistent with our desired target gene sequence. This result demonstrates that synthesized SCIN gene is properly inserted in our SCIN overexperessing pEGFP-N 1-3FLAG vector.4. Our western blot results shows that the KD3 siRNA target have a significant inhibitive effect in SCIN expression and, therefore, is an effective target. The sequence is CCGGCACGAAGATGAGCTGACAACATTTCAAGAGAATGTTG TCAGCTCATCTCGTGTTTTTG. The lentivirus with KD3 target siRNA vector is selected for viral package. The titer reaches 2×109 TU/ml.5. Results from MTT assay reveals that cell proliferation in colorectal cancer SW480 and DLD-1 cell lines carrying si RNA-SCIN is repressed obviously. The number of recombinant plasmid-transfected cells passing through the Transwell membrane were significantly lower than those of untransfected cells. The OD value is obviously decreased at day 5 compared with untransfected cells (P＜.05).6. Results from Transwell assay revealed that the number of DLD-1 cell lines, carrying siRNA-SCIN, passing through the Transwell membrane were significantly lower than those of untransfected cells. Meanwhile, the invasion rate is significantly lower comparing to control cells (P＜.05). SW480 cell lines passing through the Transwell membrane demonstrate in a similar manner to DLD-1 cell line. The invasion rate of SW480 carrying siRNA-SCIN is lower in comparison with control cells (P<0.05).Conclusion1. The RNAi-SCIN lentivirus vectors and pEGFP-3FLAG-SCIN overexpressing vectors are successfully constructed.2. The up-regulation gene expression is related to hepatic metastasis of colorectal cancer.3. It is possible that the up-regulated SCIN gene expression induces F-actin depolymerization, resulting in remarkable changes in cytoskeleton and, subsequently, leading to development of hepatic metastasis of colorectal cancer.4. SCIN gene will be a forecasting index and a new target of therapy in liver metastasis of colorectal cancer in the futureKey words:liver metastasis of colorectal cancer; gene-chip; SCIN; F-actin; RNA interference;... |
PDF Full Text Request