Relationship Of Gastrointestinal Hormones And Pharmacol Factors With Motility Of Oddi Sphincter, Gallbladder And Formation Of Cholelithiasis | | Posted on:2007-05-02 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:Z H Zhang | Full Text:PDF | | GTID:1104360182992262 | Subject:Surgery | | Abstract/Summary: | PDF Full Text Request | | IntroductionGallbladder stone is a common and frequently occuring illness worldwidely. Researches of recent years showed that gallbladder stone had intimate relationship with carcinoma of gallbladder. The morbidity of cholecystolithiasis was 7% and 12% in England and American seperately. The incidence rate of gallstone in our country is 8% averagely, among them more than 80% are gallbladder stones. The main component of gallbladder stone is cholesterol, but the mechanism of gallstone formation is not very clear. The abnormal lipid metabolism, the disturbence between nuclear promoting factor and nuclear inhibiting factor, the disorder of gallbladder and sphincter of Oddi motor function and lithogenic genes may all played important roles. Nowadays, more and more attentions were payed to the disorder of gallbladder motility, it may play an important role in the formation of gallstone. Many neuro and hormone factors and their interaction regulate the gallbladder motility and bile flowing into the duodenum. Further research of these factors may be help in the discuss of etiology of gallbladder diseases and improve the treatment. Our study detected the level of motilin, gastrin and vasoactive intestinal peptide in blood and gallbladder tissues of 36 patients with gallbladder stones, 14 patients with gallbladder polyps, 11 patients with common bile duct stones, 10 healthy people and 7 gallbladder tissues of donors of liver transplantation as controls were measured by radioimmunoassay and diss-cussed the relationship between the levels of gastrointestinal hormones and the pathogenesis of cholelithiasis.Materials and methods1. Patients36 patients who suffered with gallbladder stones (14 men, 22 women, and mean age 58.4 years) ,14 patients with gallbladder polyps (4 men, 10 women, and mean age 46. 6 years) , 11 patients with common duct stones (3 men, 8 women, and mean age 61.0 years) , 10 healthy volunteers (7 men, 3 women, and mean age 45. 6 years) and 7 gallbladder tissues of donors of liver transplantation as controls were selected at the second affiliated hospital of China Medical University between JUL. 2004 and DEC. 2004.2. The collection and preservation of samples6 ml blood was drained from the vein of patients and healthy volunteers in the early morning and was put in three test tubes individedly. Two of them were filled with 30 μl 10% ethylene diamine tetraacetic acid disodium and 30μl apro-tinin. Then the samples were centrifuged for 15 min at 1500 roll/min, the serum and plasma isolated were put in Eppendorf tubes and stored in deep freen refrigerator at -70℃.The gallbladder tissue was taken from the bottom of the gallbladder which weighed 300mg, and then boiled at 100℃ in the saline for 3min, 0. 5ml of 0. 1N hydrochloric acid was added and be made into homogenate, then lay up for 1.5 hours at 4℃. and 0. 5ml of 0. 1N NaOH was added, centrifuged at 3000 roll/ min for 30 min, supernatant was taken and be put in Eppendorf tubes and stored in deep freen refrigerator at — 70℃.3. Measurement of motilin, gastrin and vasoactive intestinal peptideThe level of motilin, gastrin and vasoactive intestinal peptide in blood and gallbladder tissues were measured by radioimmunoassay. The sample of serum, plasma and gallbladder tissues thoroughly mixed together before measurement, centrifuged at 1500roll/min for 15min, supernatant was taken and tested. The motilin radioimmunoassay kit was supply ed by Peking Fu Ri Biological Engineering Company. The gastrin radioimmunoassay kit was supplyed by Peking Ke Mei Dong Ya Biotechnologicai Limited Company and the vasoactive intestinal peptideradioimmunoassay kit was supplyed by the Navy Radioimmunoassay Technique Center. Before the gallbladder tissues were tested, preliminary experiment was done. As to gastrin and motilin, stock solution would be used while samples be diluted for 150 times when measurement of vasoactive intestinal peptide be done.Statistic analysis was carried out using the Students t - test. Data were putinto computer and software SPSS 11.5 was used. The results were expressed asmean SD. Levenes test was used to test the homoscedasticity of the data, t' testwould be used when data had no homoscedasticity. A double - tailed p value of<0.05 was considered to be statistically significant.Results1. The levels of plasma and gallbladder tissue moltin of the gallbladder stone group were much higher than that of control group and gallbladder polyps group. (P<0.05).2. The level of serum gastrin of the gallbladder stone group was much higher than that of the other three groups while there was no significant difference in the other three groups. (P <0.01) The level of tissue gastrin of the four groups had no apparent difference.3. The levels of plasma and gallbladder tissue vasoactive intestinal peptide of the gallbladder stone group were much higher than that of the control group and the gallbladder polyps group. (P <0.05 ) While the level of plasma vasoactive intestinal peptide of the gallbladder stone group was higher than that of the-common duct stone group.ConclusionOur study found the levels of plasma motilin, plasma vasoactive intestinal peptide, serum gastrin, motilin and vasoactive intestinal peptide in the gallbladder tissues of the gallbladder stones group all elevated abnormally. The abnormal change of the hormoral factors showed close relationship with the gallstone for-mation. Especially the level of vasoactive intestinal peptide, its concentration in the gallbladder tissues was extremely high. Its abnormal elevation in the gallbladder stones group showed it may play an important role in the pathogenesis of cholelithiasis.IntroductionRecently, more and more interests have focused on abnormal gallbladder motility in the pathogenesis of gallbladder diseases especially gallbladder stone. Gallbladder motility and bile delivery to the duodenum involve a complex interplay between neural and hormonal factors. The gallbladder is supplied by at least three types of vagal nerve fibers: cholinergic, cholecystokinin(CCK) -er-gic, and vasoactive intestinal polypeptide (VIP) -ergic. It is likely that acetyl-choline, CCK and VIP in the nerve endings function as neurotransmitters, subserving contraction and relaxation of the gallbladder musculature.VIP had been shown to relax the gallbladder. The studys had shown that VIP reduces gallbladder tone basally and inhibits CCK - stimulated contraction in a dose - dependent manner. VIP exerts its action through receptors in the gallbladder wall. VIP binds to two subtypes of VIP receptors (VPAC - R) , previously called VIP1 and VIP2 receptors, because they also have a high affinity for pituitary adenylate cyclase - activating polypeptide ( PACAP) , and therefore were recently named VPAC, and VPAC2 receptors (VPAC1 - R and VPAC2 -R). A medline research found no research about the expression of VPAC, and VPAC2 receptors mRNA in gallbladder tissues. The purpose of this study is to detect the expression of VPAC1 - R and VPAC2 - R mRNA in gallbladder tissues and to find out the roles they played in the process of gallstones and gallbladder polyps formation.Materials and methods1. PatientsThe gallbladder tissue of 25 patients with gallbladder cholesterol stones (12men, 13 women, and mean age 59.6 years, range 34 - 75 years ) and 8 patients with gallbladder cholesterol polyps (2 men, 6 women, and mean age 46. 8 years, range 26-64 years) was obtained from surgery. The patients who had a history of acute cholecystitis were excluded. The gallbladder tissue of 7 donors of liver transplantation was taken as controls. The tissue was taken at least 200 milligrams, then quick frozen in liquid nitrogen and stored at -80 CC.2. Extraction of RNATotal RNA was extracted from 100 mg gallbladder tissue samples using TR-Izol reagent, according to the manufacturers instructions. The concentration and purity of RNA was determined by spectrophotometer at 260 and 280 nm.. All RNA isolates had an OD26o:OD280 between 1. 8 and 2. 0, indicating clean RNA isolates.3. Reverse Transcription -Polymerase Chain Reaction (RT -PCR)The primers for amplifying VPACj - R and VPAC2 - R cDNA were designed by the corresponding software based on the published Homo sapiens VPAC, - R mRNA (NM 004624) and VPAC2 - R mRNA(NM 003382) sequence. Primers for VPAQ -R mRNA;forward 5'- AGATGCAGCTCACTAC-CCTAT -3', and reverse 5'- TTCAGAGTCCCTCAGTCCTT -3', which generated a 179 - bp amplification product. Primers for VPAC2 - R mRNA;forward 5'- TGCTGCAACAAGCTCATCCCT -3', and reverse 5'- GACCC AACACCT TCAGTTACCAC - 3', which generated a 380 - bp amplification product. Primers for internal reference gene (3 - actin were used to monitor the quality of the RNA samples, forward 5'- TCTGGATCACCTTCTGCTG G -3', and reverse 5 V GATTGCTCAGGACATTTCTG -3;which generated a 690 - bp amplification product.Two micrograms of total RNA was used as a template for subsequent RT and PCR reactions. It was combined with 1 jxl oligo( dT) 15, 1 jxl dNTPs and H20 and preheated at 65°C for 1 min to denature secondary structures. The mixture was then cooled rapidly to 30°C and then 10 jjj 2X RT Buffer, 4|jJ 25% MgSO4, 1 fxl 22u/|xl AMV, 0. 5|xl.40u/(xl Rnase - Inhibitor were added. Reverse Tran-scriptase was added for a total volume of 20 |xl. The RT mix was incubated at 65°C for 30 min. then stopped by heating at 98°C for 5 min and cooling at 5°Cfor 5 min.Polymerase chain reactions were performed on a PTC - 200 PCR machine using 3(xl of cDNA, 0. ljxl each oligonucleotide primer, 2jjl1 of each dNTP, 0. 2|xl Taq Polymerase and 10X Taq polymerase buffer in total volume of 25jxl. The PCR program initially started with a 94°C denaturation for 3 min, then 94°C for 45 seconds, followed by 35 cycles of annealing at 52. 2 C for VPACj - R mRNA and 57. 3 C for VPAC2 - R mRNA for 1 minute, and extension at 72 C for 1 minute, followed by final extension at 72 C for 7 minutes.The PCR products were analyzed by electrophoresis on 2% agarose gels containing ethidium bromide. The gels were photographed on top of a 280 nm UV light box. The gel images were digitally captured with a digital camera and analyzed with the ID Kodak Imager analyze program. RT - PCR values are presented as a ratio of the receptor mRNA signal divided by the (3 - actin signal.4. Statistical Analyses.Data are expressed as mean ± SE. Statistical analyses were performed by using the independent two - tailed t test. All P values of <0. 05 was considered to be statistically significant. The SPSS11. 5 software was used for statistical analyse.ResultsTotal RNAs isolated from gallbladder tissues were subjected to reverse transcription PCR analysis for the expression of mRNA for VPACj and VPAC2 receptors. A 179 -bp band and a 380 - bp band, specific for VPA^ and VPAC2 receptors , were found in gallbladder tissues of the all three groups as illustrated in Fig. 1,2. Furthermore, we applied RT - PCR assay as a tool for the semiquanti-tative assessment of VPACJ and VPAC2 receptors mRNA. The level of amplified VPAC! and VPAC2 receptors mRNA PCR product corrected to amplified (3 - actin mRNA by RT - PCR was compared in three groups.1. Expression of mRNA for VPAC, receptor in gallbladders tissues of all the three groupsThe VPACj receptor mRNA level of the control group (1.15 0.23) showedno apparent difference with that of the gallbladder polyps group(1.28 0.56) and the gallstone group. ( 1. 27 0. 38 ). ( Table 1).2. Expression of mRNA for VPAC2 receptor in gallbladders tissues of all the three groupsThe VPAC2 receptor mRNA level of the control group (1. 09 0. 58) was lower than that of gallbladder polyps group (1. 64 0.56) and gallstone group(1.55 0.45 ) ( P <0.05) while the expression of VPAC2 receptor mRNA showed no difference between the gallbladder polyps group and gallstone group. (Table 1)ConclusionThe abnormal expression of VPAC2 receptor mRNA in the gallbladder tissues played an important role in the formation of gallbladder stones and gallbladder polyps.IntroductionEndoscopic sphincterotomy(EST) had already been an important means in treating choledocholithiasis. A research suggested that 50% of the patients after endoscopic sphincterotomy had biliary gas indicating reflux of duodenal contents. Another research suggested that the duodenal - biliary reflux rate was as high as 100% in the patients after EST. The stone recurrence rate was 9.8% in the patients with EST. But in patients after cholecystectomy for gallbladder stones, the choledocholithiasis recurrence rate was only about 2. 5% . Thus, we may see that as a surgery destroying the sphincter of Oddi, EST can result in duodenal - biliary reflux which may have close relationship with the recurrence of choledocholithiasis.The stone recurrence rate was about 10. 3% in patients with T tubes after cholecystectomy and choledochotomy which had no apparent difference with that of patients after EST. whether sphincter of Oddi hypomotility and duodenal - biliary reflux existed in these patients and if these patients had abnormal secretion of gastrointestinal hormones need further research. Our research detected if the duodenal - biliary reflux existed by measuring the amounts of radioactivity of Tc99m - labeled diethylene triamine pentaacetic acid (DTPA) in the bile from the T tubes, investigated whether the patients with duodenal - biliary reflux had sphincter of Oddi hypomotility, detected the level of plasma motilin and serum gastrin of the patients and discussed the relationship of duodenal - biliary reflux with sphincter of Oddi hypomotility, serum gastrin and plasma motilin.Materials and methodsPatients45 patients who underwent cholecystectomy and choledochotomy, at least 1.5 months (mean 2. 5 months) after T tube drainage (16 men, 29 women, and mean age 58. 9 years) were selected at the Second Affiliated Hospital of China Medical University between APR 2004 and AUG 2005. They were divided into reflux group and non - reflux group by measuring the amounts of radioactivity of Tc99m - labeled diethylene triamine pentaacetic acid (DTPA) in the bile and their blood was taken at fasting state in the morning for detecting serum gas-trin and plasma motilin. The blood of 12 healthy volunteer(9 men, 3 women, and mean age 51. 6 years) was taken as control. 34 patients (12 men, 22 women, and mean age 58. 3 years) were selected for sphincter of Oddi manome-try according to the methods of randomly and double - blinded.Observation of duodenal - biliary refluxThe patients were fasted overnight and took lml water orally containing 185 MBq( 5mCi) mTc - DTPA, then drunk 240ml water and took prostrate position. The bile of the succeed two hours were collected and 20ml of the bile were taken for detecting. The intensity of radioactivity was counted in the RM905 radioactivity detecting meter. If there was radioactivity detected in the bile, the patient was thought to have duodenal - biliary reflux. All Tc - DTPA were prepared just before administration and their radiochemical purity was detected by radio-chromatograph. The radiochemical purity of "To - DTPA was more than 99% while the free Tc was less than 1%.Detection of plasma motilin and serum gastrin4 ml blood was drained from the vein of patients and healthy volunteers in the early morning and was put in two test tubes individedly. One of them was filled with 30[xl 10% ethylene diamine tetraacetic acid disodium and 30fxl apro-tinin. Then the samples were centrifuged at 1500 roll/min for 15 min and the serum and plasma isolated were put in Eppendorf tubes and stored in deep freen refrigerator at - 10°C.The level of plasma motilin and serum gastrin were measured by radioimmu-noassay. The sample of serum or plasma thoroughly mixed together before measurement, centrifuged at 1500 roll/min for 15 min, supernatant was taken and beBiotechnological Research Institute. The gastrin radioimmu - noassay kit was supplyed by the Isotope Researcher Center of the China Atomic Energy Academy.Method and apparatus of sphincter of Oddi manometryA triple lumen polyethylene manometry catheter 200 cm in length with an outer diameter of 1. 7mm was used for manometry. The three side holes in the distal end were located 2mm apart. Sterile water was infused through the catheter at a flow rate of 0. 5ml/min by a hydraulic capillary infusion system. PC polygraph HR ( Swedish CTD - Synetics medical company) and relevant program were used to record and analyze the tracings. Manometry was performed after all the stones were removed from the common bile duct. The catheter was introduced via the side - pore of choledochoscope into duodenum directly, when the pressure was stable, duodenal pressure - curve was recorded. It was then withdrawn in a stepwise fashion, the position of catheter in the sphincter could be confirmed by direct observation through choledochoscope or by the characteristic pressure changes on the screen. The Oddi's sphincter and common bile duct rao-tility tracings were recorded respectively.Basal pressure of Oddi s sphincter ( BPOS) , amplitude of phasic contractions ( SOCA) , frequency of phasic contractions ( SOF) , duration of phasic contractions (SOD) , duodenal pressure (DP) and common bile duct pressure (CBDP) were recorded and analyzed with a special computer program.Statistic analysis was carried out using the Students t - test. Data were put into computer and software SPSS 11.5 was used. The results were expressed as mean SD. Levenes test was used to test the-homoscedasticity of the data, ttest would be used when data had no homoscedasticity. A double - tailed p value of <0. 05 was considered to be statistically significant. Pearson correlation test was used to test the correlation of the data.Results1. Duodenobiliary refluxThere is 16 patients who had duodenal - biliary reflux among the 45 pa-tients who underwent cholecystectomy and choledochotomy and T tube drainage. (35. 6% )The mean technetium counts of the bile from the 16 reflux positive patients was 132.73 ±246.07KBq( counting performed at the second hour after ingesting the isotope). None of the rest 29 bile samples had been detected of any radioactivity.2. Plasma motilin and serum gastrinThe level of plasma motilin (377. 54 ± 130. 44pg/ml) and serum gastrin (68. 33 ±28. 56 pg/ml)of the reflux group is apparently lower than that of the control group and the non - reflux group.3. Manometry of SO34 patients were selected(12 men, 22 women, and mean age 58.3 years) for sphincter of Oddi manometry according to the methods of randomly and double - blinded. Among them 13 was divided into the relux group and 21 into the control group by measuring amounts of radioactivity of Tc99m — labeled diethyl-ene triamine pentaacetic acid (DTPA) in the bile.The sphincter of Oddi s basal pressure, amplitude, common bile duct pressure in the reflux group is significantly lower than in the non - reflux group ( P < 0. 001) , the duration of contractions of reflux group is shorter than that of non -reflux group while there is no significant difference in the frequency of contractions and duodenal pressure between the two groups. The change of SOCA is most remarkable. The mean value of the reflux group is lower than half of the non - reflux group. In the reflux group, there is 10 patients whose DP is higher than SOBP (76. 9% ) and 8 patients whose DP is higher than CBDP (61. 5% ) while there is no patient whose DP is higher than SOBP and only 2 patients whose DP is higher than CBDP (9.5%) in the non - reflux group.4. Pearson correlation testThere is no evident correlation between the level of plasma gastrin and serum motilin (the coefficient of correlation is 0. 146) while the level of plasma motilin showed obviously positive correlation with sphincter of Oddi basal pressure (the coefficient of correlation is 0. 366 ) (p < 0.05 ) and the level of serum gastrin showed apparent positive correlation with sphincter of Oddi basal pressure (the coefficient of correlation is 0. 429) ( p < 0. 05 ) and common bile ductpressure (the coefficient of correlation is 0. 359 ) ( p < 0.05 ).ConclusionOur study found that many patients with a T tube after cholecystectomy and choledochotomy do have duodenal - biliary reflux. Most of them do have sphincter of Oddi hypomotility and the level of plasma motilin and serum gastrin decreased. The level of plasma motilin showed obviously positive correlation with sphincter of Oddi basal pressure and the level of serum gastrin showed apparent positive correlation with sphincter of Oddi basal pressure and common bile duct pressure. The disorder of gastrointestinal hormone secretion may result in sphincter of Oddi dysfunction and the sphincter of Oddi hypomotility caused by it had intimate relationship with duodenal - biliary reflux and recurrence of gallstones.IntroductionMorphine can cause excitatory effect on Oddi's sphincter motility and therefore induces upper abdominal pain with characteristics of biliary colic in some patients. Morphine could increase intrabiliary duct pressure, and delay bile flow to the duodenum, for this reason, other opioid analgesics rather than morphine are recommended clinically to relieve the pain, especially biliary pain. It is believed that pethidine has less effect on the sphincter than morphine and therefore is usually the drug of choice for pain relief in acute pancreatitis. Because of potential interference, all narcotic analgesic drugs, including pethidine, are proscribed during Oddi's sphincter manometry (OSM). However, the performance of OSM with only diazepam sedation was difficult as pethidine markedly improves ERCP tolerance.The aim of this study was to evaluate the effects of three analgesic drugs on human Oddi's sphincter motility by choledochoscope manometry, and to understand the different clinical responses to analgesics.Materials and methodsPatientsOSM was performed for 30 patients ( 10 men, 20 women, and mean age 57 years, ) with PENTAX choledochoscope at the Second Affiliated Hospital of China Medical University between November 2001 and December 2003. All patients underwent cholecystectomy and choledochotomy, at least 1.5 months (mean 2. 5 months) after T tube drainage. The patients were fasted overnight before manometry.MethodsA triple lumen polyethylene manometry catheter 200cm in length with anouter diameter of 1. 7mm was used for manometry. The three side holes in the distal end were located 2mm apart. Sterile water was infused through the catheter at a flow rate of 0. 5ml/min by a hydraulic capillary infusion system. PC polygraph HR ( Swedish CTD - Synetics medical company) and relevant program were used to record and analyze the tracings. Manometry was performed after all the stones were removed from the common bile duct. The catheter was introduced via the side - pore of choledochoscope into duodenum directly, when the pressure was stable, duodenal pressure - curve was recorded. It was then withdrawn in a stepwise fashion, the position of catheter in the sphincter could be confirmed by direct observation through choledochoscope or by the characteristic pressure changes on the screen. The Oddis sphincter and common bile duct mo-tility tracings were recorded respectively. Drugs were administered intramuscularly at 10 min intervals.Patients were randomly administered one of the three different drugs. Pethi-dine was administered in a dose of 1 mg/kg after the first measurement , the second and third manometries were performed respectively 10 min and 20 min later. Each of the other two analgesics was administered in a dose of lmg/kg also. The procedures were the same as that of the pethidine group.Basal pressure of Oddi s sphincter ( BPOS ) , amplitude of phasic contractions (SOC A) , frequency of phasic contractions (SOF) , duration of phasic contractions ( SOD ) , duodenal pressure ( DP) and common bile duct pressure (CBDP) were recorded and analyzed with a special computer program. Statistical analysis was carried out using the Students t - test. Data were expressed as mean SD . A double - tailed P value <0.05 was considered statistically significant.ResultsThirty patients with T - tubes had no evidence of ampullary abnormality underwent OSM. Clear tracings of pressure and phasic contractions were acquired. Data were compared.1. Effect of pethidine on Oddis sphincter motilityNo statistical difference before and after administration of pethidine (1 mg/ kg). Pethidine showed no apparent effect on Oddis sphincter motility.2. Effect of Ap -237 on Oddis sphincter motilityMarked increased levels of BPOS, SOCA and SOF were observed 10 min after injection of Ap - 237, and high levels of BPOS and SOF persisted for 20 min ,which showed an excitatory effect on Oddis sphincter motility.3. Effect of tramadol on Oddis sphincter motility .Levels of BPOS and SOCA were obviously reduced 10 min after administra - tion of tramadol, which maintained at low levels for 20 min and showed an 1 inhibitory effect of tramadol on Oddis sphincter motility.ConclusionAll these findings indicate that Oddis sphincter manometry via choledocho-seope is a practical and new way to study the dynamics of Oddi's sphincter. The regular dose of Ap -237 could increase BPOS, SOF and SOCA. Pethidine had no effect on Oddis sphincter motility. Tramadol showed an inhibitory effect on the motility of the sphincter of Oddi and decreases levels of BPOS and SOCA. | | Keywords/Search Tags: | motilin, vasoactive intestinal peptide, gastrin, gallbladder, radioimmunoassay, VPAC1-R, VPAC2 -R, RT-PCR, Gallbladder disease, sphincter of Oddi, Tc99m - labeled diethylene triamine pentaacetic acid, pressure, duodenal - biliary reflux, choledochoscope | PDF Full Text Request | Related items |
| |
|