| Objective: Angiotensin-converting enzyme (ACE) inhibitors have been widely used in therapy for hypertension, congestive heart failure and myocardial infarction. However, ACE inhibitors also have adverse effects, the most common of which is cough, limiting the use of these drugs. Why ACE inhibitors cause coughing is not completely understood. To investigate the genetic susceptibility associated with cough related to ACE inhibitors therapy, Polymerase Chain Reaction (PCR) coupled with Single-Strand Conformation Polymorphism (SSCP) was used to detect polymorphism of ACE gene insertion/deletion (I/D) and bradykinin B2 receptor gene promoter -58T/C. Linkage analysis is carried out to evaluate the association of polymorphism of the two genes with cough induced by ACE inhibitors.Methods: The participants were randomly selected from inpatients with hypertension, congestive heart failure or myocardial infarction at department of cardiology, the second hospital of Hebei Medical University. All study subjects were of Han Chinese origin, with no consanguinityassociation each other. None had any history of recent respiratory infection, chronic bronchitis or asthma. We classified the study population into 2 groups: with and without cough (cough+ and cough- ) respectively. The DNA of the subjects was extracted from leukocytes by use of the UNIQ-10 DNA extracting kit (Biological Engineering Company, Shanghai). For detection of ACE I/D polymorphism, the primers for PCR amplification were: forward, 5'—CTGCAGACCACTCCCATCCTTTCT—3',and reverse, 5'—GATGTGGCCATCACATTCGTCAGAT—3', amplifying the intron 16 region where the I/D fragment is located. The total reaction volume was 50ul in a mixture containing 0.1 ug of genomic DNA, 200 umol/L of each dNTP, 0.4 umol/L of each primer, 1.5 mmol/L Mgcl2, and 2.5 U of Taq DNA Polymerase. Cycle conditions for PCR were initially 2 minutes at 94℃, followed by 50 seconds at 94℃, 1 minute at 55℃, and 1 minute at 72℃ for 35 cycles, with a final extension time of 5 minutes at 72℃. PCR products were subjected to analysis in a 1.5% agarose gel. Detection of promoter -58 Thymidine/Cytosine (T/C) polymorphism of the human bradykinin B2 receptor gene was as follows. The primers for PCR amplification were: forward 5'—GCAGAGCTCAGCTGGAGGAG—3',located in the promoter, and reverse 5'—CCTCCTCGGA GCCCAGAAG—3', located in the promoter/exon 1. The total reaction volume was 50 ul in a mixture containing 0.1 ug of genomicDNA, 200 umol/L of each dNTP, 0.4 umol/L of each primer, 1.5mmol/L Mgcl2, and 2.5 U of Taq DNA Polymerase. Cycle conditions for PCR were initially 3 minutes at 94℃, followed by 1 minute at 94℃, 50 seconds at 60℃, and 1 minute at 72℃ for 35 cycles, with a final extension time of 5 minutes at 72℃. PCR products were subjected to Single-Strand Conformation Polymorphism electrophoresis. A 5ul of the PCR products was diluted with the same volume formamide, denatured at 95℃ for 10 minutes, and subjected to SSCP analysis in a 20% polycrylamide (2×TBE) gel. The gels were then silver- stained. Several samples representative of each genotype detected by SSCP were sequenced by fluorescent cycle sequencing to confirm the Thymidine (T) or cytosine (C) at nucleotide position -58 upstream from the transcription start site. All statistical analysis were performed using the Statistical Package for Social Science (SPSS version 10.0) program. Results: A total of 145 patients with hypertension, myocardial infarction or congestive heart failure receiving Captopril completed the study. After 2 weeks of therapy, 27.59% (40 of 145) of all patients were found to have ACEI-related cough and most with ACEI-related cough was female (26 of 40). The ratio of male to female was about 1/2. 1. The distribution of the I/D genotypes and allelic frequencies of the ACE gene polymorphism. The genotypes and allelic frequencies were in hardy-weinberg equilibrium.The distributions of the I/D genotypes were 45.00% for II, 35.00% for ID and 20.00% for DD in patients with ACEI-... |