| Objective:The patients with recurrent cerebral infarction were taken as the research object,and the information,like ALDH2,GSTM1 genotype,4-HNE content,were determined.Then using a group of patients who did not relapse within one year as a control group,and utilizing statistical analysis to find out the risk factors of the recurrent cerebral infarction,the aim was to provide information to formulate the measures for secondary prevention of recurrent cerebral infarction.Methods:Using cohort study,patients with initial cerebral infarction in hospitals of Tai’an area were collected as experimental subjects,and the number,admission time,age,gender,alcohol abuse,smoking history,hypertension,hyperlipidemia,diabetes and other data were recorded.The age of the subjects ranged from 35 to 85,with the average age of 61.32.By monthly follow-up survey,2m L of peripheral blood of each patient was collected when they came back to the hospital to review and stored the blood in the refrigerator at-20℃.The serum was extracted to determine the content of 4-HNE with ELISA kit.To get the DNA with Hi Pure Blood DNA Mini Kit,and with the ALDH2,GSTM1 gene as the primer(ALDH2-F:5‘TCATGCCATGGCAACTCCAGC3’,ALDH2-R:5‘TGATCCCCAGCAG-GTCCTGAA3’,GSTM1-F:5‘GAACTCCCTGAAAAGCTAAAGCTCT3’,GSTM1-R:5‘CTTGGGCTCAAATATACGGTGGAG3’)to get the ALDH2(upstream:5‘TCATGCCA-TGGCAACTCCAGC3’,downstream:5‘TTCAGGACCTGCTGGGGATCA3’),GSTM1(upstream:5‘GAACTCCCTGAAAAGCTAAAGCTCT3’,downstream:5‘CTCCACC-GTATATTTGAGCCCAAG3’).ALDH2 genotype(rs671)was gotten by Sanger sequenc-ing,GSTM1 genotype was gotten by Southern Blot.According to the medical record tracking and statistical analysis,the recurrence rate and the data of smoking,alcohol abuse,hypertension,hyperlipidemia,diabetes control rate and medication compliance of the patients were recorded.According to Hardy-Weinberg law of genetic equilibrium,evaluating the frequency distribution of ALDH2 and GSTM1 genotype in the recurrent group and the non-recurrent group byχ2 test with SPSS Satistics 22.Logistic regression analysis was used to find out the risk factors for the recurrent cerebral infarction among the factors:age,gender,history of alcohol abuse,smoking history,hypertension,hyperlipidemia,diabetes,4-HNE content,ALDH2,GSTM1 genotype and ALDH2/GSTM1combined genotype.Risk factors for the increase of 4-HNE content were determined by multiple linear regression analysis.Using 4-HNE content as the test variables,to make Receiver Operating Characteristic(ROC)Curve with recurrent cerebral infarction,and get the AUC and the cutoff.Results:The smoking history,alcohol abuse,hypertension,hyperlipidemia and diabetes history mentioned in this study were all the living habits and medical history of the patients before initial attack of cerebral infarction1.During one-year follow-up,the recurrence rate of cerebral infarction patients was0.309.2.According to Hardy-Weinberg law of genetic equilibrium,the ALDH2 and GSTM1polymorphisms were tested byχ~2,P>0.05,proved that the experiment subjects were representational;3.The distribution of ALDH2 between the recurrence group and the non-recurrence group of cerebral infarction was compared byχ~2test,the results(P=0.045<0.05)showed that there was significant difference in the distribution of ALDH2 gene between the two groups,indicating that ALDH2 mutation was a related factor for the recurrence of cerebral infarction4.The distribution of GSTM1 between the recurrence group and the non-recurrence group was analyzed byχ~2 test,the results(P=0.200>0.05)showed that there was no significant difference in the distribution of GSTM1 gene between the two groups;5.The distribution of ALDH2 and GSTM1 combined genotypes between recurrence group and the non-recurrence group of cerebral infarction was evaluated byχ~2test the results showed that ALDH2*1/GSTM1(+)(P=0.500>0.05),ALDH2*1/GSTM1(-)(P=0.423>0.05),ALDH2*2/GSTM1(+)(P=1.000>0.05)had no significant difference in distribution between the two groups,but the ALDH2*2/GSTM1(-)genotype(P=0.014>0.05)had significant difference between the two groups,indicating that it was a related factor for recurrent cerebral infarction;6.All the factors such as age,gender,4-HNE content,smoking history,alcohol abuse,hypertension,hyperlipidemia,diabetes were analyzed by using univariate logistic regression analysis,the results showed that 4-HNE content(P=0.000,OR=57.706,95%CI14.625-197.211),alcohol abuse(P=0.000,OR=9.519,95%CI4.620-19.615),hyperten-sion(P=0.009,OR=2.460,95%CI1.250-4.844)were related factors for recurrent cerebral infarction7.Taking recurrence of cerebral infarction as the dependent variable,multivariate logistic regression analysis was performed,using 4-HNE content,alcohol abuse,hypertension,ALDH2*2/GSTM1(-)genotype as independent variables,the results showed that 4-HNE(P=0.000,OR=1688.332,95%CI121.363-23487),alcohol abuse(P=0.008,OR=3.683,95%CI1.405-9.653),hypertension(P=0.000,OR=0.063,95%CI0.014-0.297),ALDH2*2/GSTM1(-)(P=0.023,OR=0.139,95%CI0.025-0.762)were risk factors of recurrent cerebral infarction;8.All the factors such as age,gender,smoking history,alcohol abuse,hypertension,hyperlipidemia,diabetes,ALDH2 genotype,GSTM1 genotype and ALDH2/GSTM1 geno-type were analyzed by multivariate linear regression,the results showed that age(P=0.030,95%CI0.014-0.259),alcohol abuse(P=0.000,95%CI0.229-0.507),hypertension(P=0.000,95%CI0.178-0.453),ALDH2 gene polymorphism(P=0.000,95%CI-1.374--0.635),GSTM1gene polymorphism(P=0.032,95%CI0.057-1.236),ALDH2*2/GSTM1(-)genotype(P=0.000,95%CI0.945-1.215)were risk factors for the 4-HNE content.9.The ROC curve of 4-HNE content for recurrent cerebral infarction was obtained.AUC was 0.870 and the best critical value was 0.81.Conclusion:1.4-HNE content,alcohol abuse,hypertension,ALDH2*2/GSTM1(-)genotype were proved to be risk factors for recurrent cerebral infarction;2.Aging,alcohol abuse,hypertension,ALDH2 gene polymorphism,GSTM1 gene polymorphism,ALDH2*2/GSTM1(-)genotype can lead to the increasing of 4-HNE content,they were proved to be risk factors of the content of 4-HNE;3.4-HNE can be considered as an indicator of recurrent cerebral infarction,and its cutoff is 0.81μmol/L. |
PDF Full Text Request