| Objective:To investigate the expression of hsa_circ_0001785 in different molecular subtypes of invasive ductal carcinoma of the breast and paracancerous tissues.To explore the correlation between its expression level and molecular subtypes of invasive ductal carcinoma of the breast and other clinicopathological features.Methods :1.A total of 28 cases of invasive ductal carcinoma of the breast and paracancerous tissues in our hospital were collected from March 2019 to September 2020.Based on postoperative pathological data,the patients were divided into 4 groups according to the international consensus classification criteria of the 2013 St.Gallen Conference on Breast Cancer:Luminal A(13cases),Luminal B(6cases),HER2 overexpression(4cases),and TNBC(5cases).2.The gene sequence of hsa_circ_0001785 was retrieved from the database.According to the design principle of circ RNA primers,the hsa_circ_0001785 primer was designed using Primer software.The amplified region covered the shear site and became back-to-back reverse primers.After RNA extraction,reverse transcription and PCR amplification,the specificity of the amplified product was detected by agarose gel method.The second-generation sequencing verified that the gene sequences were consistent with those in the database.3.The expression level of hsa_circ_0001785 in tumor and paracancerous tissues was detected by qRT-PCR.The difference of expression level between the two was analyzed.The expression of hsa_circ_0001785 in different molecular subtypes of invasive ductal carcinoma of the breast was analyzed.The correlation between hsa_circ_0001785 expression level and clinicopathological characteristics such as tumor diameter,lymph node metastasis,histological grade,and age was analyzed.Results:1.Through the second-generation sequencing test,the primers designed in this experiment had good specificity and the amplified product sequence was consistent with that in the gene bank.2.The expression level of hsa_circ_0001785 in 28 cases of invasive ductal carcinoma of the breast and paracancerous tissues was detected.The statistical results showed that hsa_circ_0001785 had low expression in 23 cancer tissues.In the low expression sample,the outcome was more than 2 times downregulated in 17 cases and 6 cases were meaningless.The expression level of hsa_circ_0001785 in 5 cases of invasive ductal carcinoma of the breast was higher than that in adjacent normal tissues,of which the up-regulated result was more than 2 times in 2 cases,and 3 cases were meaningless.The statistical results showed that hsa_circ_0001785 was down-regulated(P<0.05)in invasive ductal carcinoma of the breast.3.The expression of hsa_circ_0001785 in different subtypes of breast cancer was not statistically significant.4.The expression level of hsa_circ_0001785 was significantly correlated with the histological grade of invasive ductal carcinoma of the breast(P<0.05)and lymph node metastasis(P<0.05),but not with the patient’s age(P>0.05)and tumor size(P>0.05).Conclusions:Verify primers,forward CATGGGTCTGGGAAAATCGC,reverse TCGACACTGTATTCCGAGGT is a specific primer for hsa_circ_0001785.Hsa_circ_0001785 is down-regulated in infiltrating ductal carcinomaof the breast.Its expression level correlates with tumor grade and lymphnode metastasis.The lower the expression level,the lower the degree of tumor differentiation,the more lymph node metastasis.The expression level of Hsa_circ_0001785 was not significantly correlated with the age and tumor size of patients with invasive ductal carcinoma,nor was it significantly correlated with the molecular classification of invasive ductalcarcinoma of breast. |