Research On Thrombocytopenia In MYH9-related Disorder By Gelsolin Regulated Cytoskeleton With Apoptosis Mechanism

Objective: In order to explore the mechanism of gelsolin regulation of microfilament cytoskeleton and apoptosis in MYH9-related disorder,a MYH9 gene expression vector with MYC tag was constructed to conduct in vitro experiments for a MYH9-related disorder family.Methods:1.MYC tag was inserted after the N-terminal promoter ATG in MYH9 gene to construct the wild-type and mutant-type MYC-MYH9-pc DNA3.1(-)fusion expression vectors,and Hela cells were transfected with plasmid.2.The aggregation of NMMHC-ⅡA in transfected cells was detected by immunofluorescence staining using MYC polyclonal antibody.3.The localization and expression of gelsolin in transfected cells were detected by immunofluorescence staining and western blotting.4.The microfilament cytoskeleton morphology of transfected cells was analyzed by rhotamine-labeled TRITC-phalldidin immunofluorescence staining.5.Apoptosis of transfected cells was detected by Annexin APC and7-AAD on flow cytometer.Results:1.In this study,the wild-type and mutant-type MYC-MYH9-pc DNA3.1(-)fusion expression vectors with MYC tag were successfully constructed.2.Immunofluorescence staining showed that the wild-type and mutant-type group were positive and the empty plasmid transfection group was negative,indicating that MYH9 fusion expression vectors were successfully expressed in Hela cells.In the wild-type group,NMMHC-ⅡA localization was cytoplasmic diffuse.However in the mutant-type group,rod-shaped NMMHC-ⅡA accumulation was observed.3.Immunofluorescence staining showed that gelsolin was uniformly distributed in the wild-type group.However in the mutant-type group,gelsolin was aggregated and distributed spot-like,and some were located in the actin stress fiber bundles and arranged in filaments which were distributed at the edge of cells.Western blotting showed that the expression of gelsolin/GAPDH in mutant-type group(0.5±0.04)was significantly higher than that in the wild-type group(0.3±0.04)(P<0.01).4.Immunofluorescence staining showed that the F-actin stress fibers were uniformly arranged in the same direction in the wild-type group.However,in the mutant-type group,the microfilaments showed aggregation of small masses and some microfilaments were formed central voids state,indicating that the F-actin was reduced and disordered.5.Flow cytometry showed that the apoptosis rate of Hela cells in the wild-type group(24.2%±0.9%)was significantly higher than that in the mutant-type group(5.5%±0.3%)(P<0.0001).Conclusions: In vitro experiments,this study confirmed that the frameshift mutation of MYH9 exon41 c.5818＿5819ins AATGGCCCGGAAAGGCGCCG was the molecular pathogenesis of MYH9-RD.Gelsolin mediated abnormal fibrocytoskeleton rearrangement and anti-apoptotic effect may be the important pathogenesis of thrombocytopenia in MYH9-RD.This study provides a new research direction for further exploring the pathogenesis of MYH9-RD and theoretical basis for targeted therapy.