Cloning And Bioinformatic Analysis Of Candidate Gene TaG3LEA On QTL Qfhb.yzu-4B For Resistance To Fusarium Head Blight In Wheat

We found one gene associated with Fusarium head blight resistance in wheat in previous proteome research in our lab,and the gene encodes group 3 late embryogenesis abundant(G3LEA)protein and this protein is only enriched in resistant varieties.Previous studies have shown that this gene is widely involved in regulation processes of growth,development and resistance to various adversity in higher plants.In this research,the CDS sequence of TaG3LEA gene in wheat was obtained from the American National Biotechnology Information Center Database(NCBI)and aligned with the reference sequence of wheat variety "Chinese Spring",and we found the gene was located in the known QTL interval of Fusarium head blight resistance on 4B chromosome.According to the previous association analysis results,Japanese wheat variety TOKAII66 carries favorable vanation while American wheat variety Clark carries unfavorable allele variation in the known QTL of Fusarium head blight resistance on 4B chromosome.Primers were designed to amplify the full-length DNA sequence,and the full-length of TaG3LEA gene in wheat varieties TOKAII66 and Clark were amplified,respectively,then the amplified products were purified,cloned and subsequently sequenced.The gene-specific marker that could distinguish the resistance and susceptible allele variations were developed according to the base differences,and were used to analyze 244 wheat varieties to determine the distribution of different allele variations in a natural population.Next the expression patterns of wheat TOKAII66 and Sumai 3(carrying unfavorable alleles at the target site)at different grain-filling stages were analyzed after inoculations with E g and mock(mung bean soup),respectively.Afterwards the evolution of TaG3LEA family genes in wheat was analyzed.The main results are as follows:(1)The gene has a 668 bp CDS sequence,and it has two exons and one intron.A pair of primers for amplification of the full-length DNA sequence was designed in the predicted region of 5 'and 3y UTR using the Primer Premier 5.0 software:AAGTCCACTTGGTGTAACTTTGTAGT and AACTGCAGGGCTATGATCCTTCGCGGT.The gene was isolated in resistant wheat variety TOKAII66 with favorable allele and susceptible variety Clark with unfavorable allele.The results showed that there was only one SNP(C/T)variation between TOKAII66 and Clark,which was located 1 KB upstream of the initial codon and was the core base of cis-acting element EBOXBNNAPA ABRE(ABA response element).Then the SNP was transformed into CAPS marker that could be used in marker-assisted breeding.(2)The gene-specific marker was analyzed in a natural population consisting of 244 wheat varieties,and two haplotypes were identified there were 2 haplotypes totally,which were consistent with the previous association analysis by Li et al(Breeding Science 2016).(3)qPCR showed that the relative expression of TaG3LEA gene in TOKAII66 is significantly higher than in Sumai 3 at 6 hours after inoculation of.g.The overall level of relative expression of TaG3LEA gene in TOKAII66 was higher than that in Sumai 3 in most sampling time points although the relative expression of TaGSLEA gene in TOKAII66 shows the downward trend after 6 hai?suggesting that this gene may be closely related to the resistance level of wheat Fusarium head blight.(4)A total of 26TaG3LEA genes(TaG3LEA-1?TaG3LEA-26)were identified in the whole wheat genome.The results showed that these 26 genes were distributed on nine chromosomes including 1A,IB,ID,3A,3B,3D,4A,4B and 4D,and tandem duplication and fragment replication were the main ways of gene expansion of the wheat TaG3LEA family.Phylogenetic trees of five crops were categorized into three groups,and TaG3LEA genes in wheat were classfied into the second and the third group.MEME analysis showed that members of the family contained motif 2 or motif 5,and there were motifs composed of 11 amino acids which were the featured characteristic of the family.