Font Size: a A A

Regulatory Mechanism Of Para-nitrophenol Degradation In Pseudomonas Putida DLL-E4

Posted on:2018-07-31Degree:MasterType:Thesis
Country:ChinaCandidate:F HuangFull Text:PDF
GTID:2370330575467313Subject:Microbiology
Abstract/Summary:
Para-nitrophenol(PNP)is the most important pollutant of nitrophenolic pollutant,has been applied to multiple areas,can remain in the environment for a long time.At the same time PNP has toxic effect on the blood,liver and central nervous system of human and animal.Nowadays a large number of PNP-degrading microorganisms have been isolated,and the pathway of PNP-degrading and the related genes of PNP-degrading have been studied extensively.But studies on the regulatory mechanism of PNP-degrading related genes are still few.Pseudomonas putida DLL-E4 is a PNP-degrading strain that separated and stored by our laboratory.There are two PNP degradation gene clusters pnp and pnpl in the genome of strain DLL-E4.In previous studies,we found that the second gene cluster pnpl can not degradate PNP;gene pnpA in the first gene cluster can convert PNP to HQ,gene pnpC1C2 in the first gene cluster can degradate HQ.The proteins that pnpR and pnpRl code are LysR-type transcriptional regulators.PnpR can positively regulate transcription of pnpC1C2,PnpR and PnpRl can positively regulate transcription of pnpA.Based on these studies,this study use the modern biotechnology research method to elucidate the specific regulatory mechanism of LysR family regulatory protein on PNP-degrading related genes and the catalytic mechanism of PNP-degrading related genes.To study the regulatory mechanism of PnpR and PnpR1 that regulates the transcription of pnpA,PnpR and PnpRl was heterologously expressed in E.coli BL21,purified protein PnpR and PnpRl can bind with the promoter DNA of pnpA in vitro,results of EMSA show that PnpR and PnpRl can bind the promoter DNA of pnpA irrespective of the presence of inducer.Use gfp as the reporter gene to study the inducer that is necessary for PnpR and PnpRl to activate the transcription of pnpA.The promoter DNA of pnpA(PA)was fusion expressed with pnpR and pnpRl,green fluorescent protein GFP was used as the repoter gene in situ to detect the transcription of pnpA,then the constructed plasmid pBBR-pnpR-PA-gfp and pBBR-pnpR1-PA-gfp was introduced into P.putida KT2440.The fluorescence intensity was used to detect whether the transcription was activated to determine the inducer.Western blot was used to study the interaction between inducers.We found that there are three inducers can activate PnpR-regulated pnpA transcription:PNP,4-NC and y-Hydroxymuconic semialdehyde.The presence of y-Hydroxymuconic semialdehyde decreases the affinity of PnpR for PNP and 4-NC.The results also show that there are two inducers can activate PnpRl-regulated pnpA transcription:PNP and 4-NC,and these two inducers act synergistically to activate pnpA expression.The level of PnpRl-regulated pnpA transcription was higher in response to two inducers than the transcription level due to each alone.By detecting the PNP degradation ability of the recombinant strains,we found that the regulation of PnpRl is stronger than PnpR.To study the regulatory mechanism of PnpR that regulates the transcription of pnpC1C2,purified protein PnpR can bind with the promoter DNA of pnpC1C2 in vitro,results of EMSA show that PnpR can bind the promoter DNA of pnpC1C2 irrespective of the presence of inducer.DNase I footprinting show that PnpR was bound with the 29 bp sequence "CAGTGTTTGCGAAACGCGAACACTGCTCA" on the promoter of pnpC1C2,which are at positions from-82 bp to-54 bp upstream of the transcription initiation site.The presence of the inducer PNP enhances the binding strength of PnpR to the promoter region.Also use gfp as the reporter gene to study the inducer that is necessary for PnpR to activate the transcription of pnpC1C2.The promoter DNA of pnpC1C2(Pc1)was fusion expressed with pnpR,green fluorescent protein GFP was used as the repoter gene in situ to detect the transcription of pnpC1C2,then the constructed plasmid pBBR-pnpR-PC1-gfp was introduced into P.putida KT2440.The fluorescence intensity was used to detect whether the transcription was activated to determine the inducer.We found that there are three inducers can activate pnpC1C2 expression:PNP,4-NC and γ-Hydroxymuconic semialdehyde.Western blot analysis show that γ-Hydroxymuconic semialdehyde is the most suitable inducer,and these three inducers act synergistically to activate pnpC1C2 expression.The level of PnpR-regulated pnpC1C2 transcription was higher in response to two or three inducers than the transcription level due to each alone.Since PnpA is the key enzyme for the first step of PNP degradation,in-depth study of its catalytic mechanism will help to deeply understand the regulation of PNP degradation process.Therefore,research on the key sites of the enzyme by site-directed mutagenesis has been studied,and laid a theoretical foundation for the further study of the catalytic mechanism of the enzyme.By means of site-directed mutagenesis experiments and related enzyme kinetic analysis,suggested that the E42,Q115 were the key sites for FAD binding;the R179,R282 were the key sites for NADH binding;the D297 was the key site for FAD binding or substrate PNP binding;the specific role of P304 is unknow,but its mutations can cause the loss of protein activity.
Keywords/Search Tags:Pseudomonas putida DLL-E4, p-nitrophenol, hydroquinone, regulatory mechanism, LysR-type transcriptional regulator, site-directed mutagenesis
Related items