FinR Regulates Expression Of NicC And NicX Operons Involved In Nicotinic Acid Degradation In Pseudomonas Putida KT2440

Pseudomonas putida KT2440 is a non-pathogenic model strain with broad metabolic diversity and strong adaptability to different environments.In addition to being used as a model strain for studying the basic metabolism,Pseudomonas putida KT2440 is also widely used in production practice.The study of its survival mode and basal metabolic pathways can help and guide the partical production and application.FinR is a conserved transcriptional regulator of LysR family in Pseudomonas,which is responsible for inducing the expression of ferredoxin-NADP(+)reductase Fpr-1 under oxidative stress and enhancing the ability of the strain to resist oxidative stress.Except for this information,we know little about FinR function at present.In this study,11 novel target genes regulated by finR were screened from Pseudomonas putida by transcriptome sequencing and qRT-PCR,and the physiological functions and mechanisms of FinR regulating nicC and nicX operons were further explored.The following conclusions were derived:1.Both transcriptome sequencing and qRT-PCR revealed that FinR significantly regulates the expression of nicC and nicX operonsPrevious studies have found that FinR is responsible for the induction of ferredoxin-NADP(+)reductase Fpr-1 expression under oxidative stress conditions,but little is known about other functions.In order to explore other functions of FinR,the transcriptome sequencing was used to find genes with significant changes in expression in finR mutant compared with wild-type strain.Then we validated the results of transcriptome sequencing by qRT-PCR,and we found that 11 operon may be regulated by FinR.Among them,the expression of the nicC and nicX operons in the finR mutant was significantly decreased,and the expression of the two operons was restored in the complement of the finR mutant.2.Deletion of finR weakened the efficiency of NA utilizationThe nicC and nicX operons belong to the nic cluster,which consists of 11 genes responsible for the aerobic degradation of nicotinic acid(NA).We constructed seven nic promoter-lacZ reporter vectors,the result of enzyme activity assay showed that the promoter activity of nicC and nicX was significantly lower in the finR mutant than that in the wild type,and no significant changes were observed in other promoter.It was consistent with the qRT-PCR results.To verify whether FinR affected the strain's metabolism of nicotinic acid,bacterial NA utilization experiments were performed.The results showed that the deletion of finR impaired bacterial growth in the minimal medium supplemented with NA / 6HNA(6-hydroxynicotinic acid)as the sole carbon source.And the complement with intact finR restored the growth of mutant strains.It shows that the deletion of finR weakened the efficiency of NA utilization.3.FinR and NicR synergistically regulate nicC and nicX operonsNicotinic acid is a carboxylic acid derivative of pyridine,which is widely distributed in nature as a pyridine cofactors and part of alkaloids,and is essential for organisms that can not synthesize vitamin B3.It can be used as the sole carbon and nitrogen source for some bacteria and fungi.Previous studies have shown that NicR is a MarR-like protein that inhibits the activity of the nicC and nicX promoters,and 6HNA is an inducing molecule.Our previous results indicate that FinR is positively regulating the activity of the nicC and nicX promoters.To investigate the relationship between NicR and FinR regulators inducing expression of nicC and nicX operons in the presence or absence of inducers,we constructed a nicR signal mutant and a nicRfinR double mutant and compared the expression levels of nic genes in the presence and absence of NA / 6HNA by qRT-PCR.The deletion of finR greatly reduced the effect of nicR deletion on the expression of nicC and nicX operons.In the presence of NA/6HNA,the expression of nicC and nicX operons was induced in the wild type and the finR mutant,while not in the nicR mutant and the nicR finR double mutant.These results indicate that the inhibitory function of NicR plays a major role in regulating the expression of two operons,and completely induction requires a positive effect of FinR.4.FinR and NicR bind nicC and nicX promoters in vitroIn the Nicotinic acid metabolic pathway of Pseudomonas putida KT2440,NicR is a repressor of nicC and nicX operons,but whether NicR directly binds to the nicC and nicX promoters is unknown.To further verify whether FinR and NicR bind to the nicC and nicX promoters,the FinR and NicR proteins were purified and subjected to Gel retardation assay(EMSA).The results indicate that FinR / NicR protein can interact specifically with the promoter DNA of nicC and nicX operons in vitro.DNase I footprint assay determined that the NicR protein specifically binds to the GATTTAGAGCGTATACGCTA sequence in the nicC promoter and the AAGTAGGGTGTACACACTAT sequence in the nicX promoter.Promoter truncation fragment experiments confirmed that the FinR and nicC promoter binding sites are located between-19 and-120,and the nicX promoter between-102 and-204 relative to the translation initiation codon.Our results revealed the physiological functions and mechanisms of FinR regulation of Nicotinic acid metabolism in Pseudomonas,and expanded our understanding of FinR.It also laid the foundation for further exploration of other functions of FinR in the future.