Font Size: a A A

Screening Of Novel Nucleic Acid Aptamers For Albumin And CD19

Posted on:2018-10-01Degree:MasterType:Thesis
Country:ChinaCandidate:X O LiFull Text:PDF
GTID:2350330518462706Subject:Pathology and pathophysiology
Abstract/Summary:
Objective:Proteomics is one of the imperative methods to investigate biomarkers of diseases.However,the majority of the significant biomarkers are low abundance proteins,whose assessment is often interfered by the high abundance proteins.As a consequence,the sensitivity of proteomics would decrease.Albumin is the most abundant protein within the body.In the blood,more than 80 percent of plasma proteins are albumin.Albumin also widely exists in other body fluids,including cerebrospinal fluid,urine,saliva,and tears.Therefore,in order to improve the accuracy of protein analysis and to identify more biomarker proteins,it is necessary to remove albumin from samples for proteomic study.At present,the main measure to eliminate albumin is antibody-based.However,antibodies are relatively expensive and do not have a good structural stability under certain conditions,limiting the scope of its application.In addition to antibody,aptamer can also recognize and bind to protein structures specifically.Aptamers are short strands of DNAs or RNAs that can fold into complicated tertiary structures,which can bind to target molecules with high affinity and selectivity.Advantages of using aptamers over antibodies are that aptamers are stable and inexpensive.Moreover,aptamers can be easily tailor-made and chemically modified.These characteristics make aptamers potential substitutes of antibodies.So far,there is no report of an albumin aptamer in current literature.In this study,we developed an albumin aptamer,which may serve as the basis for a new technology for albumin removal.Methods:Using the SELEX technique and albumin as the target,we selected an aptamer that can bind to albumin.Flow cytometry was employed to monitor the process of SELEX and evaluate the aptamer’s s bindings of the aptamer to albumin and non-target proteins,including IgG,trypsin,and ovalbumin.Results:(1)The selected aptamer A6 is a 59-base DNA.The sequence of A6 is 5’-TGCGTGTGTAGTGTGTCTGCGCTGTTCTATGCCTTCGGCGCTCTTAGGGATT TGGGCGG-3’.(2)A6 could efficiently bind to albumin with a Kd of 77.4 nmol/L.(3)A6 had minimal cross-reactivity to IgG,trypsin,or ovalbumin.Conclusions:In this study,a novel DNA aptamer against albumin was selected.The aptamer could recognize albumin with high affinity and has a relatively lower cross-reactivity to non-target control proteins.The aptamer may serve as an albumin-catching ligand and function in a new technique for removing albumin from proteomic samples.Objective:Lymphoma is a major threat to human health,and its incidence is on the rise in recent years.Targeted therapy is an important strategy to treat lymphoma,because it can not only destroy the tumor cells but reduce the side-effects.CD 19 is a valuable therapeutic target for lymphoma treatment.Lymphoma can be categorized into Hodgkin’s lymphoma(NL)and Non-Hodgkin’s lymphoma(NHL),and the majority of NHL are B-cell lymphoma.CD 19 is highly expressed in B-cell lymphoma,and thus may serve as a potential target for treating NHL.Targeted therapy demands targeting ligands.In addition to antibodies,aptamers may also function as targeting ligands.Aptamers are short strands of DNAs or RNAs,which can bind to target molecules through complicated structures,such as hairpin,stem-loop and so on.These special structures provide aptamer a firm foundation to recognize target specifically.Compared to antibody,a significant advantage of aptamer is its low production cost,since aptamers can be chemically synthesized and mass-produced in vitro.Aptamer also possesses certain advantages as a tumor-targeting ligand,including low immunogenicity,rapid penetration into tumor tissue,and qualitative stability.These features make aptamer a powerful molecule for targeted therapy.So far,however,no CD 19 aptamer has been reported in literature.In this study,we selected the first aptamer that can bind to CD 19 protein.Moreover,we evaluated the binding property of this aptamer to CD 19-expressing lymphoma cells.In addition,we built an aptamer-doxorubicin complex,and evaluated its efficacy against CD 19-positive lymphoma cells.Methods:Using the SELEX technique and CD 19 protein as the selection target,DNA aptamer that can bind to CD 19 protein was selected.Flow cytometry was employed to monitor the bindings of the aptamer to CD 19 protein,albumin,and ovalbumin.The bindings between aptamer and CD 19-expressing lymphoma cells(Ramos and Raji)and control cells(Jurkat and NB4)were evaluated with flow cytometry and confocal microscopy.The incorporation of doxorubicin(Dox)into aptamer to formed the aptamer-doxorubicin complex(Apt-dox)was monitored with fluorescence spectrum.Confocal microscopy was employed to evaluate the uptake of Apt-dox complex by both CD 19-positive lymphoma cells and CD 19-negative cells.MTS assay was used to evaluate the cytotoxicity of Apt-dox complex against CD 19-positive lymphoma cells and the CD 19-negative control cells.Results:(1)The aptamer selected is a 59-base single-strand DNA.Its primary sequence is 5’-TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTT GGGCGG-3’.(2)The aptamer L7 can recognize CD 19 protein structure with a Kd of 85.4 nmol/L,with minimal cross-reactivity to other proteins like albumin and ovalbumin.(3)Moreover,L7 can bind strongly with the CD 19-expressing lymphoma cells(Ramos and Raji),but weakly with the CD-19 negative control cells(Jurkat and NB4).(4)An aptamer-doxorubicin complex(Apt-dox)was formulated by intercalating doxorubicin into L7.Apt-dox was found capable of carrying doxorubicin into CD 19-positive lymphoma cells,and significantly reducing the drug intake by CD 19-negative cells.(5)Apt-dox complex retained the efficacy of doxorubicin against CD 19-positive lymphoma cells,but lowered the toxicity to CD19-negative cells.Conclusion:The first DNA aptamer against CD 19 was selected in this study.It can bind to CD 19 protein with decent affinity and specificity.In addition,the aptamer is able to recognize CD 19-expressing lymphoma cells,and has minimal cross-reactivity to CD 19-negative cells.The Apt-dox complex can selectively deliver the cytotoxic agent doxorubicin to CD 19-positive cells,while reducing the drug uptake by CD 19-negative cells.The results suggest that the CD 19 aptamer L7 may have potential application in targeted therapy against CD-19-expressing tumors.
Keywords/Search Tags:Albumin, SELEX, Aptamer, Lymphoma, Targeted therapy, CD19
Related items