The Effects Of Knocking BLM Helicase Gene Using CRISPR/Cas9 On Proliferation Of Prostate Cancer Cells

RecQ helicase family is an important family of DNA helicases and plays a crucial role in DNA replication,repair,recombination,transcription,cell metabolism and genetic stability.BLM helicase is important one of five RecQ family members and its mutation of BLM helicase gene can lead to the BLM syndrome with a high incidence of cancer,such as prostate cancer,breast cancer,melanoma.Many scientific studies have proven that the tumor results from the expression of certain genes up regulated or down regulated in the cell proliferation differentiation and apoptosis disorder.The previous research results also show that the high expression of BLM helicase are commonly found in many cancer cells.The specific inhibition of BLM helicase may alleviate cancer cells with high proliferation rate.It suggested that this enzyme may be a molecular target for anticancer drug action.CRISPR/Cas9 technology belongs a new kind of genome targeted modification technology,which can be employed for site specific change of biological genome.At the present,CRISPR/Cas9 technology has been used in many animal models of gene knockout studies on successful cases.However many methods are the application of direct injection mode to get or use animal cell marker gene.BLM gene knockdown of human prostate cancer cell by CRISPR/Cas9 did not appeared.In the current,we designed 4 gRNAs and CRIPSR/Cas9 vector as well as Donor vector to replace BLM gene entirely by contransfection.Then we screened cells with BLM helicase gene knockout by puromyci and researched its biological characteristics in the previous and the after about knockout BLM gene by MTT experiment,scratch test,Transwell chamber experiment,etc.The main results are as follows:1.Construction of CRISPR/Cas9 targeting vector The 4 different gRNAs of recognizing BLM gene was designed and they were inserted into Pcag-T7-cas9 + Grna-pgk-Puro-T2A-GFP vector.We had a success for construction of 4cas9 vectors identified by sequencing.2.Detection of the targeting efficiency of CRISPR/Cas9 vector The shearing efficiency was detected by means of T7E1 assay.The electrophoresis result showed that only gRNA4(AAACACCGAGTCCTTTGTAAGTAGCAAC)was successful for knockout BLM gene because of two bands.3.Construction of Donor vector Using the active gRNA4,the homologous arm was designed to construct the Donor vector.Sequencing results showed that the double stranded oligonucleotide was inserted into the plasmid successfully and the sequence was correct.The Donor vector was successfully constructed.4.Detection of biological characteristics of BLM knockdown cells By MTT method,scratch test and Transwell assay,It was found that comparing with wild type cells,knockdown cell growth rate was obviously slower,healing ability and invasion ability had been decreased but its ability was increased apoptosis.These results suggest that BLM gene plays a role in regulating cell growth and proliferation.