Font Size: a A A

CRISPR-Cas9 Mediated Site-specific Mutation In Rat Angiomotion Gene

Posted on:2017-04-07Degree:MasterType:Thesis
Country:ChinaCandidate:B LanFull Text:PDF
GTID:2334330518452631Subject:Pharmacology
Abstract/Summary:
Objective: This study aimed to introduce point-mutation into the rat genome via direct injection of CRISPR-Cas9 into one-cell embryos, establishing rat models for further AMOT gene function study and laying the foundation of gene therapy.Methods: (1) gRNA design and in vitro validation: gRNA was designed with the website based CRISPR design tool (http://crispr.mit.edu/). A 500 bp length DNA fragment of angiomotin gene that locates around the mutation point was amplified and mixed with the designed gRNA, Cas9 protein to form an in vitro reaction system; After one hour’s incubation in 37℃, the mixture was separated by agarose gel electrophoresis to check the activity of the CRISPR-Cas9 system. (2) Microinjection and mutant rat construction:Prepubescent female rats were injected with 30IU pregnant mare serum gonadotropin, followed by an injection of 20IU of human chorionic gonadotropin 48 h later, and immediately mated with SD males. Fertilized one-cell stage embryos were collected from oviducts on the next day and cultured in M2 at 37℃, 5% C02 for 2 h and then prepared for microinjection.Zygotes were injected with a mixture of Cas9 protein (10 ng/μl), sgRNA (8 ng/μl) and a single-stranded donor oligonucleotides (3 ng/μl),which encodes the p.49P50G mutation of angiomotin. Surviving embryos were implanted on the same day in the oviduct of pseudo-pregnant females (0.5 dpc) and allowed to develop to full term.(3) Genotyping and homozygous rat construction: Genomic DNA was extracted from tail biopsy samples and a 500 bp length DNA fragment of Amot gene was amplified. The PCR product was firstly cut by AvaI restrictive endonuclease,whose cut site was intentionally introduced into the homologous recombination template for genotyping purpose, to check possible homologous recombination.Animals carrying homologous recombination were further subjected to Sanger sequencing to establish founder rats (F0). F1 generation was obtained by crossing F0 with wild-type rats and genotyped by T7E1 endonuclease mismatch analysis. Homozygous female rats were produced by crossing between the F1 animals.Results: (1) gRNA design and in vitro validation: The sequence of designed gRNA is CTCCATTCTCCACTGGCAGT GGG, Results from the in vitro reaction system showed that while Cas9 alone couldn’t cut the Amot PCR product, the designed gRNA guided Cas9 to digest the DNA fragment efficiently.(2)Microinjection and mutant rat construction: Ninety-eight fertilized eggs were injected in total and 80 egges (82%) survived. After implanted into pseudo-pregnant rats, 32 pups (40%) were delilvered. AvaI restrictive digestion revealed 1 pup (3%) underwent homologous recombination. Sanger sequencing results confirmed this pup as founder rat (F0). (3) Genotyping and homozygous rat construction: After crossing F0 with a wild-type rat, ten F1 rats were delivered, of which 4 were males carrying the mutation on their X chromosomes,while 2 were heterozygous females. By crossing between F1 animals, we got 2 homozygous male, 2 homozygous female and 6 heterozygous female rats.Conclusion: In conclusion, a heritable site-specific mutation was successfully introduced into the rat genome with the CRISPR/Cas9 system. This one-step method of generating site-specific mutation in rats will greatly accelerate the in vivo study of gene functions.
Keywords/Search Tags:CRISPR-Cas9, gRNA, homologous recombination, non-homologous end joining
Related items