Research On DNA Bar Coding Of The Marketed Pilose Antler Slices And Centipedes As Well As Site-specificity Of Centipedes

Objective: To determine a suitable method for DNA extraction of pilose antler slices and centipedes, study the feasibility of applying DNA bar coding into the identification of the commercially available pilose antler slices and centipedes, and probe into the feasibility of characteristic PCR technique in identifying centipedes on the foundation of mitochondrial COI sequence. Methods: 1) Perform DNA extraction of the sold pilose antler slices and centipedes with transgen kit, tiangen kit and CTAB method; conduct purity and concentration tests via nucleic acid protein instrument and electrophoresis gel imaging system to determine the suitable extraction method; 2) Conduct PCR amplification of the DNA extracted from the sold dry pilose antler slices and centipedes with COI universal primer, perform cloning purification of PCR amplification products of pilose antler slices via TA cloning method, and conduct sequencing of the plasmids and bacterial liquid of the purified pilose antler slices, together with the centipede products collected after PCR gel-cutting through Nucleic acid sequencing machine ABI3730XL; 3) Perform similarity retrieval in GenBank of the sequences obtained and download the sequences required, then conduct sorting and matching of the sequences acquired, and calculate GC content through sequencing with software like DNAMAN and MEGA6.06 Molecular Evolutionary Genetics Analysis software, calculate genetic distance with K-2p, and construct system clustering tree with neighbor joining method; 4) Design a pair of identification primers that are exclusively used in identifying the site-specificity of the dry centipedes on the basis of complete gene sequence analysis of COI between qualified and spurious centipedes, and conduct PCR amplification of the sample with identification primers to observe the negative and positive results. Results: 1) Comparing the DNA genome extracted with two kits and CTAB method shows that the DNA purity is higher with tiangen kit extraction(the kit that is used at first). When tiakgen kit fails to satisfy the extracted concentration, the CTAB method can be applied. The DNA concentration is higher with CTAB method extraction, which guarantees the DNA extraction of dry TCM materials; 2) Mitochondrial COI universal primers have good amplification on the DNA genome extracted from the sold pilose antler slices and centipedes. Target bands are bright, and non-targeted bands can be seen indistinctly. TA cloning method compensates for the low purity of DNA extracted in early stage. Single sequence of the pilose antler slices and centipedes obtained through sequencing, without any disturbance peak can be seen from the sequencing peak, indicating successful sequence results through sequencing; 3) After conducting BLAST in NCBI, it can be tentatively determined that sample No.5, No.8 and No.3-a of pilose antler slices collected are spurious, while the dry centipedes collected are all qualified. According to system clustering tree, it can be found that the No.5 and No.8 sample of pilose antler gather with reindeer, and sample 3-a is an independent branch. Two qualified TCM materials gather together, while individual species may form independent branches, with the approval rate of ≧50. The condition of system clustering tree is consistent with BLAST results; 4) The authenticity of the sold centipedes can be determined through specific primers that aim at centipede COI sequences and designed by Primer software. The results of PCR amplification gelelectrophoresis show that there is one single bright band in qualified centipedes, and no bright band in spurious ones. Conclusion: 1) It is feasible to perform DNA extraction of dry pilose antler slices and centipedes with tiangen kit and CTAB method, which provides method reference for DNA extraction of the same-kind market-available TCM materials; 2) It is feasible to identify the authenticity of the sold dry pilose antler slices and centipedes directly with DNA bar coding of COI sequence, and it is worthy of promoting in the identification of market available animal materials, providing new methods for identifying animal materials and choosing investigation materials; saving manpower, material and financial resources that are required during the collecting, storing and transporting of origin animal tissues or blood; and highlighting the convenience and intuition of treating the sold materials as object of study. The application of TA cloning method in purifying PCR products compensates for the low DNA purity during DNA extraction; 3) The specific primers WG-F: CGGTCCAGCATGAGTAATATTTGA and WG-R: AGGAAGTTTAATC GGAGATGAT can be used in identifying the sold medicinal centipedes, offering more stable and faster methods of identification.