| Background & Aims:KLF8 is a member of the KLF transcription factor family that plays an important role in oncogenesis; It possesses highly conserved zinc finger domains at its C-terminus that binds to the CACCC region of target gene promoters. KLF8 was first reported as a transcriptional repressor of beta-globin gene expression. It has subsequently been identified as a critical regulator of cell proliferation, oncogenic transformation, epithelial to mesenchymal transition （EMT）, tumor invasion and metastasis. Although considered widely expressed, KLF8 expression is barely detectable in most normal cell and tissue types, but highly increased in a number of human cancer types including breast, ovarian , renal , liver , gastric and brain cancer. Thus, KLF8 has emerged as an important cancer-regulating protein. However, the role of KLF8 in colorectal cancer remains unknown. Our aims were to examine KLF8 expression in colorectal cancers, to determine the role of KLF8 in cell differentiation and to investigate the antiproliferative effect of KLF8 silencing.Materials and MethodsChemicals, tissue specimens, and cell linesSodium butyrate （NaB） and 5-FU were purchased from Sigma （St. Louis, MO）, and rhodamine-phallotoxin was purchased from Molecular Probes （Eugene, OR）. Goat anti-human KLF8 and GAPDH antibodies were purchased from Aviva Systems Biology （San Diego, CA）. For western blot analyses,14 pairs of colorectal cancer and adjacent normal tissues （>5 cm from the margin of the tumor） were obtained from patients by surgical resection in the Nanfang Hospital （Guangzhou, China）. Informed consent was obtained from all individual participants included in the study. The Medical Ethics Committee of Nanfang Hospital approved the use of tissue specimens in this study. The tissue specimens were snap-frozen in liquid N2 and stored at-70℃ until use. The tissues were embedded in paraffin, sliced and then subjected to histopathologic review using immunohistochemistry .Tissues in which>10% of cancer cells were positively stained were considered positive.Colorectal cancer cell lines （HCT1116, HT29, Lovo, SW620 and SW480） and the human embryonic kidney 293 （HEK293） cell line were obtained from ATCC （Rockville, MD） and cultured in RPMI 1640 medium as previously described.RNA isolation and reverse transcription-PCR analysisTotal RNA was isolated using TRI-reagent （Sigma） and then reversed transcribed using SuperScript Ⅱ（Invitrogen, Carlsbad, CA） according to the manufacturers’instructions. The sequences of the primers were as follows: carcinoembryonic antigen （CEA） forward:5’-AACCCTTCATCACCAGCAAC-3’, CEA reverse:5’-CAGGAGAGGCTGAGGTTCAC-3’; E-cadherin forward:5’-TGCCCAGAAAATGAAAAAGG-3’, E-cadherin reverse:5’-GTGTATGTGGCAATGCGTTC-3’; and GAPDH forward:5’- GTCAACGGATTTGGTCGTATTG-3’, GAPDH reverse:5’-CTCCTGGAAGATGGTGATGGG-3’. The expected sizes of the PCR products were 340,200 and 204 bp for CEA, E-cadherin and GAPDH, respectively.Western blot analysisTotal protein lysates were prepared and submitted to western blotting. The blots were probed with primary antibody followed by horseradish peroxidase-conjugated secondary antibody. Antigen-antibody complexes were visualized using the enhanced chemiluminescence system （Amersham Biosciences, UK）.Assay of anchorage-independent and anchorage-dependent cell growthScrambled siRNA （src siRNA） and KLF8 siRNA-transfected cells were plated in triplicate in plates containing 0.35% agar on top of a 0.7% agar base. Colonies were scored using Coomassie Blue staining, and only colonies containing at least 50 cells were considered viable. The Cell Proliferation Reagent WST-1, a ready-to-use colorimetric assay （Roche Diagnostics）, was also used.Apoptosis assayApoptosis was detected in cells using the Annexin V-FITC kit according to the manufacturer’s instructions （Trevigen Inc., Gaithersburg, MD） followed by flow cytometry using Winmdi 2.9. Apoptosis was also analyzed by staining cell nuclei with Hoechst 33258 and examining the cells under a fluorescence microscope. The activities of caspases 3,8, and 9 were determined using the ApoAlert caspase colorimetric assay kit according to the manufacturer’s instructions（Clontech, Mountain View, CA）.ImmunofluorescenceFor F-actin staining ,cells were fixed on coverslips and incubated with rhodamine-conjugated phallotoxin （5 U/ml, Molecular Probes） in PBS at room temperature. In addition, nuclei were stained with 1μg/ml Hoechst 33258. The coverslips were then washed, mounted, and visualized using a Zeiss Axioskop fluorescence microscope.siRNA Transfection in vitroThe siRNA duplexes consisted of 21 base pairs with a 2-base deoxynucleotide overhang （Proligo, Singapore）. The sequence of the KLF8 siRNA （NM007250, sense strand:CGAUAUGGAUAAACUCAUATT） was the same as in a previous study, and src siRNA （5’-TTCTCCGAACGTGTCACGT-3’）, which does not target any genes, was used as the negative control. The cells were transfected with siRNA duplexes using Oligofectamine （Invitrogen） according to the manufacturer’s instructions.Construction and transfection of lentivirus vectors containing KLF8 short hairpin RNATo further investigate the effects of siRNA-induced down-regulation of KLF8 expression on in vivo tumor growth, a KLF8-RNAi lentiviral vector （pGCSIL-KLF8shRNA） was constructed （Shanghai GeneChem Co, Ltd, Shanghai, China）. A GFP-lentiviral vector （pGCSIL-GFP） was used as a negative control. Double-stranded oligonucleotides encoding human KLF8-vshRNA （CCGGCTAGCATGCTACAAGCTCCA-ATTCAAGAGATTGGAGCTTGTAGCATGCTAGTTTTTG） were inserted into the short hairpin RNA （shRNA） expression vector pGCSIL （Shanghai GeneChem Co, Ltd）, and the identities of the clone were verified by sequencing.A recombinant lentiviral vector was produced by co-transfecting HEK293T cells with the lentiviral expression vector and the packaging plasmid mix using LipofectamineTM 2000 according to the manufacturer’s instructions.Infectious lentiviral particles were harvested at 48 hours post-transfection and then filtered through 0.45-μm cellulose acetate filters. The virus was concentrated, and the titer was determined by serial dilution on 293T cells.For lentivirus transduction, Lovo cells were subcultured at 1×105 cells/well in 6-well culture plates and then transduced with KLF8-siRNA-expressing （KLF8 siRNA） or src-siRNA-expressing lentivirus at a multiplicity of infection （MOI） of 50. The cells were harvested 72 hours after infection, and the transduction efficiency was evaluated by counting the percentage of GFP-positive cells.Xenograft tumor modelThis study was carried out in strict accordance with the recommendations in the Guide for the IACUC （Institutional Animal Care and Use Committee）, and the protocol was approved by the Committee on the Ethics of Animal Experiments of Nanfang Hospital （Permit Number:NFYY-2013-36）. All surgeries were performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. After the surgery, all nude mice were euthanized by sodium pentobarbital anesthesia.The antitumor effects due to transfection of the KLF8 siRNA were evaluated in vivo using nude mice xenograft models [21]. Five to six-week-old female BALB/c nude mice were bred under pathogen-free conditions at the Southern Medical University （Guangzhou, China）, and all animal studies were approved by the Southern Medical University Animal Care and Use Committee. Lenti-src-shRNA and lenti-KLF8-shRNA infected Lovo cells were harvested on exponential growth phase, washed twice in PBS, and resuspended in PBS at a density of 5 x 107 cells/ml. The cell suspension （0.1 ml; 5 x 106 cells） was then subcutaneously injected into the right flank of each nude mouse. Lovo cells infected with lenti-src-shRNA were injected into group a and c respectively. Lenti-KLF8-shRNA infected Lovo cells were injected into group b and d. Fourteen days after subcutaneous Lovo cell injection,5-FU was injected into the mice group c and d through intraperitoneal injection using a 10-ml micro-syringe （Hamilton, Reno, NV, USA）, with the dose of 50μg/kg/time, once per two days,12 times. Five mice were included in each group （for each transduced cell line）, and the tumor volumes were calculated as follows: V=（4/3） R12R2, where R1 is radius 1, R2 is radius 2, and R1< R2. The mice were then sacrificed, and the tumors were dissected, snap-frozen in liquid N2 and stored at-70℃ on day 42 after inoculation for western blot.Statistical analysisResults obtained from in vitro and in vivo experiments were expressed as means±SD and statistically evaluated using the standard two-tailed student’s t test or one-way ANOVO. If equal variances not assumed, Satterthwaite t test or Dunnett’s T3 test were used to analyze the quantities data. The results were considered significant if the p value was< 0.05.ResultsColon cancer tissues express higher levels of KLF8 protein than normal tissuesWe first showed that KLF8 protein expression was drastically increased in five cancer cell lines, i.e., HCT1116, HT29, Lovo, SW620 and SW480, compared with that in the human epithelial cell line HEK293（Fig 1）. We then measured KLF8 expression in matched normal （N） and cancerous （T） colon tissues by western blotting. Of 14 cancerous tissues,10 expressed higher levels of KLF8 than normal tissues （Fig 2）. KLF8 expression in tissue specimens collected from noncancerous or cancerous colons was also measured in situ using immunohistochemistry. We found nuclear-specific KLF8 protein expression in the carcinoma cells of all colorectal cancer samples, but KLF8 was not expressed in the control tissue, as exemplified in Fig 3 （b） and （c）. Fig 3 shows representative images of KLF8 expression in noncancerous and cancerous specimens. These findings demonstrate that KLF8 is overexpressed in colorectal cancer.Inhibition of the constitutive activation of ERK1/2 down-regulates KLF8 expressionPrevious studies have indicated that activation of the MAPK/ERK pathway is involved in the regulation of cell proliferation in colorectal cancer. Therefore, we analyzed the effect of ERK inhibition on KLF8 expression after incubating Lovo and SW620 cells with U0126, a specific MEK/ERK activation inhibitor, for 48 hours. We found that the expression of both pERK1/2 and KLF8 was significantly down-regulated in a dose-and time-dependent manner after U0126 treatment （Fig 4 & 5）.On the other hand, we observed an effect of KLF8 knockdown on the activation of ERK. After confirming the efficiency of siRNA knockdown by western blotting （Fig 6）, the expression of pERK1/2 was found to be significantly reduced after KLF8 knockdown. However, no change in the expression of ERK1/2 was observed. These findings suggest that KLF8 inhibition may play an important role in ERK activation in colorectal cancer.Suppression of KLF8-induced cell differentiation in cancer cellsTo examine the effect of KLF8 on cell differentiation, we first investigated the effects of pro-differentiation agents on KLF8 expression. Lovo and SW620 cells were treated with NaB, which significantly reduced the expression of KLF8 （Fig 7）. Next, we showed by RT-PCR that KLF8 knockdown dramatically increased the expression of the differentiation markers CEA and E-cadherin （Fig 8）. In addition, cell morphology was observed using phalloidin staining to detect F-actin localization Diffuse and generally uniform distribution throughout the cytoplasm of F-actin was exhibited transfected with KLF8 siRNA. However, src-siRNA transfected into a human colon cancer cell line presented the multiple clumps of apparently aggregate and at the rim zone of the protrusion, requiring actin polymerization （Fig 9）. Thus, those above findings suggested that knockdown of KLF8 might induce differentiation of colorectal cancer cells.Knockdown of KLF8 inhibits anchorage-dependent and anchorage-independent growthWe assessed the effect of KLF8 repression on the growth characteristics of colorectal cancer cells using the WST-1 assay. We showed that the growth rates of cells transfected with the Lovo-KLF8-siRNA after culture for 24,48 and 72 hours were respectively 0.6±0.05%,1.22±0.01% and 1.72±0.09%, whereas those of Lovo-src-siRNA cells were 1±0.05%,1.74±0.07% and 2.97±0.05%（Fig 10）. Significant differences between the growth rates of Lovo-KLF8-siRNA and Lovo-src-siRNA transfected cells were found at all three time points （p< 0.05）, and similar results were observed for SW620 cells （Fig 10）.Anchorage-independent growth is a pivotal characteristic of malignant transformation. Therefore, a soft-agar assay was carried out to identify the function of KLF8. As expected, KLF8 repression for 14 days significantly inhibited the colony-forming capacity of both Lovo and SW620 cells （Fig 11）.These data show that KLF8 knockdown inhibits anchorage-dependent and anchorage-independent growth of colorectal cancer cells.Repression of KLF8 induces apoptosis and sensitizes cancer cells to chemotherapeutic 5-FUTo investigate the mechanism by which KLF8 knockdown induces growth suppression, an apoptosis assay was performed using Annexin V-FITC and PI double staining followed by flow cytometry analysis. As shown in Fig 12, the percentage of apoptotic cells was significantly increased from 0.81% in src-siRNA transfected Lovo cells to 32.58% in KLF8-siRNA transfected Lovo cells, and similar results were found for SW620 cells （from 5.71% to 24.2%）.Apoptotic induction was further confirmed at the individual cell level using Hoechst 33258 staining. We found that the ratios of cells that were positive for condensed nuclei were higher in KLF8-siRNA transfected Lovo cells （30±2%） compared with src-siRNA-transfected Lovo cells （5±1%, p< 0.05） （Figl3）. Similar results were observed for SW620 cells.The activities of caspases 3,8 and 9 were then analyzed after KLF8 siRNA transfection and were normalized to the OD, which was measured at 405 nm. As shown in Fig 14, the activities of caspases 3,8 and 9 were significantly increased in KLF8-siRNA transfected cells compared with src-siRNA transfected cells （Fig 14, p < 0.05）.To evaluate the role of KLF8 siRNA in chemotherapy-induced apoptosis, KLF8-siRNA or src-siRNA transfected cells were treated with or without 5-FU [50 μg/ml in normal saline （NS）] followed by flow cytometry analysis. As shown in Fig 15, the apoptotic index of cells treated with KLF8 siRNA+5-FU was significantly increased relative to that of the src siRNA control cells. In addition, apoptotic morphological changes were analyzed using Hoechst 33258 staining. The ratios of Lovo cells that were positive for condensed nuclei were higher in cells treated with KLF8 siRNA+5-FU compared with the src siRNA+5-FU control cells （p< 0.05） （Fig 16）. Similar results were observed for SW620 cells.These findings suggest that KLF8 siRNA enhances the susceptibility of cancer cells to apoptotic triggers induced by 5-FU.Suppression of KLF8 sensitizes cancer cells to 5-FU-induced apoptosis in vivoTo determine whether KLF8 silencing can inhibit tumor development in vivo, lentivirus-transduced Lovo cells were subcutaneously injected into the right dorsal flank of nude mice that were also treated with or without 5-FU （Fig 17）. As shown in Fig 18, the tumor volumes of Lovo-lenti-KLF8-shRNA-injected mice were markedly smaller than that of the Lovo-lenti-src-shRNA-injected mice （a and b）. Similar results were found in the 5-FU-treated mice compared with mice not treated with 5-FU （c and d）. More importantly, mice injected with both Lovo-lenti-KLF8-shRNA and 5-FU presented the smallest tumor nodules. In Fig 19, We measured KLF8 expression in the tumor tissues of four mice groups by western blotting. Obviously, KLF8 expresses the lowest in tumor tissues of mice injected with both Lovo-lenti-KLF8-shRNA and 5-FU. Therefore, synergism between the lenti-KLF8-shRNA and 5-FU inhibits Lovo cell proliferation in vivo.Taken together, these data indicate that targeting KLF8 with lenti-KLF8-shRNA has an inhibitory effect on tumorigenesis in vivo. Furthermore, inhibition of KLF8 has a synergistic effect with 5-FU treatment in the therapy of colorectal cancer.Conclusion1. Western blot and immunohistochemical experiment verify that KLF8 is highly expressed in colorectal cancer cells and tissues.2. Western blot demonstrate that inhibition of ERK1/2 activation suppressed the expression of KLF8 in colorectal cancer cells. Furthermore, KLF8 suppression markedly inhibited constitutive ERK activation.3. RT-PCR suggests that KLF8 suppression increased the expression of two differentiation markers for colorectal epithelial cells, CEA and E-cadherin on the RNA level. Similarly, cell stains also verify KLF8 suppression increases the differentiation of cancer cells.4. WST-1 test and soft-agar assay suggest that KLF8 knockdown inhibits anchorage-dependent and anchorage-independent growth and proliferation of colorectal cancer cells.5. flow cytometry analysis and Immunofluorescence verify Repression of KLF8 induces apoptosis and sensitizes cancer cells to chemotherapeutic 5-FU.6. Xenograft tumor model verify that suppression of KLF8 significantly sensitizes cancer cells to 5-FU-induced apoptosis in vivo, suggesting that targeting KLF8 with lenti-KLF8-shRNA has an inhibitory effect on tumorigenesis, and inhibition of KLF8 has a synergistic effect with 5-FU treatment in the therapy of colorectal cancer. |
PDF Full Text Request