Role And Mechanism Of MiR-143 In Radiation-Induced Thymic Lymphoma By Targeting PD-L1

With the development of nuclear energy increasingly applied in military, industry, medicine and research, it greatly benefits us accompanied by increasingly dangerous of radiation like a double-edged sword. As one of the most important late effects, the occurrence of radiation carcinogenesis rised through the increasingly touching with radiation by the public. It had been concerned by the public and radiation related personnel. Beside the direct harm of radiation carcinogenesis to the public, the long incubation period before symptoms and the invisible characteristics of radiation carcinogenesis cause great psychological panic to the public. It had been widely and further studied by researchers all over the world.MicroRNA is a kind of endogenousnoncoding single stranded RNA consisting of 21-25 nucleotides. It is a kind of key gene expressing regulators and it works by silencing the target gene through complementary base pairing. In 1993, the first miRNA was discovered in nematode, and then thousands of miRNA were discovered in virus, plant and animal. It is estimated that there are at least 1000 miRNA in human which is about 3% of the number of human genome. For the miRNA were conservativeand each miRNA couldregulate hundreds of gene besides the big number of miRNA, the miRNA may regulate the most basic and important biological processes. It was studied that the critical biological function, such as proliferation, apoptosis, differentiation, immunity, and the occurrence of tumor were regulated by miRNA.Recently, the close regulating relationship of miRNA to tumor was found, and the miRNA was divided as oncogene like miRNA, such as miRNA-21, and anti-oncogene like miRNA, such as let-7, according to the role the miRNA played in tumorigenesis.Though it is reported that many miRNAs played regulation roles in tumorigenesis, still it is unclear how miRNA play the roles especially in radiation induced tumor.Recent years our team pursued our study on radiation carcinogenesis, and we had established a radiation induced mouse thymic lymphoma model by separated low dose radiation. Preliminary of different expression of protein and mRNA in radiation induced mouse thymic lymphoma had been done. Our miRNA chisps suggested that PD-L1 may be one of the targets of miR-143 in TITL.Programmed cell death ligand 1 (PD-L1), one of the two ligands of PD-1, is also called cluster of differentiation 274 (CD274) or B7 homolog 1(B7-H1). It was firstly discovered by the Chinese Dr Chen Lieping, and after which it was firstly cloned through CDNA expressed sequence tags by Dr Dong. It was named PD-L1 by Freeman for the finding that it could inhibit the activation of T cells after combination with PD-1. As the third member of the immunoglobulin superfamily, PD-L1 is made up of 290 Amino acids and is a type 1 transmembrane protein with the molecular weight of 40 kD. The homology of PD-L1 with B7-DC, B7-1, B7-2 and ICOS is 40%,21%,20% and 23% respectively. The human PD-L1 gene targets on the 9th chromosome while the mice PD-L1 gene targets on 19th chromosome, both of the protein structure of which contain a shortcytoplasmic region in acharged state,the hydrophobictransmembrane region and an extracellular region with a IgV and a IgCregion. The mRNA of PD-L1 exists mainly in the form of 4.2kb, while it can also exist in the form of 3.7kb and 7.2kb.PD-L1 is widely expressed on the lymphocytes in normal tissues,such as the antigen-presentingcells, T/B Lymphocytes, Dendritic cells, Macrophage and so on. PD-L1 plays a role of regulating body immunestateby repressing the activation of T cells.PD-L1 is over-expressed in most tumor tissues while low-expressed in tissues beside the tumor, which suggests that it play a key role during the occurrence and developmentprocess.This paper aims to illuminate the role of miRNA played in radiation carcinogenesis from the angle of miRNA regulating the expression of PD-L1 and furthermore regulating the immune state by combining miRNA and PD-L1, and seek the function and mechanism by regulating PD-L1 to protect from radiation carcinogenesis.There is a long way to go reveal the mechanism of radiation induced mouse thymic lymphoma for there is little had been done. How to work and how to protect from the radiation carcinogenesis for miRNA need further study.Contents of study1. The function of miR-143 in RITL. ①obsereve the expression of miR-143 between normal thymus and RITL.②observe the effects miR-143 to cellproliferation and apoptosis through over-expression and down-expression of miR-143.③observe the effects of miR-143 overexpression in tumor-bearing nude mice.2. The mechanism of miR-143 in RITL.①confirm that miR-143 promotes RITL by targeting PD-L1 in a 3’UTR dependent manner.②confirm the rescue effects of PD-L1 rescued miR-143 mediated apoptosis on EL4 cells.3. The effects of radiation to the expression of PD-L1 and the relationship of the expression of miR-143 and PD-L1 in RITL. ①The male, four week-aged BALB/c mouse were divided into 4 groups(0h,12h,24h,8h after 8Gy radiation),then detect the expression of PD-L1 of the 4groups. ②The male, four week-aged BALB/c mouse were divided into 5 groups(0Gy,2Gy,4Gy,6Gy and 8Gy 24 hours later),then detect the expression of PD-L1 of the 5 groups, ③detect the expression of PD-L1 between normal thymus and RITL.④find the relationship between the expression of miR-143 and PD-L1 in RITL.Methods:1. y ray Radiation condition:Co-60y ray Radiation provided by radiation center of the second military medical university, and the dose rate is 0.58Gy/min.2. cell culture:EL4 cells and NIH3T3 cells were cultured in high-glucose RMPI-1640 and DMEM (PAA Laboratories Ltd.)with 10% fetal bovine serum (FBS; PAA Laboratories Ltd.) respectively and maintained in a 37℃ incubator with an atmosphere of 5% CO2.3. RNA extraction and quantitative RT-PCR:Total RNA from thymic lymphoma or serums of different groups were homogenized in Trizol (Invitrogen) and isolated according to the manufacturer’s instructions.The ratio of 260/280nm was measured by a spectrophotometer(GeneQuant, Pharmacia) to determine the concentration andpurity of total RNA samples. Then RNA was reverse transcribed into cDNAin triplicate using the miScript ReverseTranscription (RT) Kit (Qiagen GmbH, Hilden, Germany) following the manufacturer’s instructions. Quantitative real-time PCR for miRNA was performed on cDNA using Lightcycle 2.0 (ROCHE) with a standardLNA miRNA Fluorescence Quantitative kit protocol (ROCHE). The relative miRNA levels were analysed using the comparativeCt method.4. Proliferation assay:Seeding in 96-well-plate at 4000 cells per well, cells were transfected using miR-143 mimics/inhibitor/Adenovirus overexpressing pre-miR-143 and negative control with 3 duplicates. Then MTT array was performed to detect the cell proliferation at 0,24,48, and 72h after transfection following manufacturer’sinstructions. The absorbance at 570nm was measured using a Spectrophotometer (Infinite F50, TecanCompany, Switzerland).5.FACS assays:FACS assays were used for detection of cell apoptosis rate and cell mean fluorescence intensity. For detection of apoptosis. Cell and tissue samples were made into single cell suspension after different treatments, and then they were labeled with annexin V-FITC and propidium iodide (PI) following the manufacturer’sinstructions. Samples were determined by Fluorescence Activated Cell Sorting (FACS) analysis (Quanta SC, Beckman Coulter Company, US) and the resultswere analyzed byCellQuest software (Becton Dickinson, San Jose, CA).For detection of B7H1 protein, Cell and tissue samples were made into single cell suspension after different treatments. They were fixed and Permeabilizatedaccording to themanufacturer’s instructions, then co-cultured with antibodies specific for B7H1, then washed with PBS and analyzed by FACS following the manufacturer’s instructions. The mean fluorescence intensity was detected to show the expression of B7H1 protein.6. MiRNA-target prediction and luciferase assay:The potential targets of miR-143 were identified by using the miRNA database TargetScan version 5.1 (http://www.targetscan.org/index.html). Luciferase assays were performed in EL4 cells using a luciferase assay kit (E1910, Promega, Fitchburg, WI, USA) according to the manufacturer’s protocolas described previously.48h after transfected in 24-well plates, the cells were harvested and lysised for luciferase assay. A luciferase activity assay wasperformed with the dual luciferase reporter assay system(Promega, Fitchburg, WI, USA) which was normalized by renilla luciferase activity.7. Adenovirus over-expressing pre-miR-143:Our work was supported by Laboratory of Viral and Gene Therapy, EasternHepatobiliary Surgical Hospital, Second Military Medical Unrversity,Shanghai, China who constructed the Adenovirus over-expressing pre-miR-143 and control vector. Firstly the pre-miR-143 were amplified by PCR using the primer:GCCACAGACAGGAAACACAGT (left) and CAGACTCGTGAAGCAGATCGT (right) and the murine genomecDNA were as a template. The sequence of mmu-miR-143 were TGTGAATATATTAAAAACCTGTTAATTGTACTCACTAAATGTCCTCCTTCTAAAT TAAGCTGTTCTTGACAAGAAAAGGAAAGAAACAAAGAAAAGAAGAGAAAAA AGGTCAAGGTTTGGTCCTGGGTGCTCAAATGGCAGGCCACAGACAGGAAACA CAGTTGTGAGGAATTACAACAGCCTCCCGGCCAGAGCTGGAGAGGTGGAGCC CAGGTCCCCTCTAACACCCCTTCTCCTGGCCAGGTTGGAGTCCCGCCACAGGC CACCAGAGCGGAGCAGCGCAGCGCCCTGTCTCCCAGCCTGAGGTGCAGTGCT GCATCTCTGGTCAGTTGGGAGTCTGAGATGAAGCACTGTAGCTCAGGAAGAG AGAAGTTGTTCTGCAGCCATCAGCCTGGAAGTGGTAAGTGCTGGGGGGTTGT GGGGGGCCATAACAGGAAGGACAGAGTGTTTCCAGACTCCATACTATCAGCC ACTTGTGATGCTGGGGAAGTTCCTCTACACAAGTTCCCCTGGTGCCACGATCT GCTTCACGAGTCTGGGCATGTCCTGACTCCTCTGTGTACCCCAGTGTGTCCAT CTTAGCATGAGGCGTTAGCATTTCCCCAGCACCCTGCCTCTGCTTTCTCTTTCT GAGCCCATGGCAGACACAGCTAATCAGTAAAG. DNA sequencing and Blastingwith the NCBI Database were used to verify the PCR products. Inserted into a pAdTrack plasmid, the sequence was named pAdTrack-CMV-miR-143 which was recombinated with pAdEasy-1 in the bacteria BJ5183. The newly recombinated plasmid named pAd-miR-143 was tested by sequencing. Ad-miR-143 was propagated in HEK293 cells from which viruses were collected and stored at -70℃.8. In vivo tumorgenecity assay:48h after infected with ad-virus or negative control, single cell suspensions of EL4 cells(3×106) were subcutaneously injected into the backs of NOD/SCIDmice. The tumor formation incidencesand the tumor size were measured twice weekly for 30 days.9. Statistical analysis:Quantitative data were expressed as means±SD.Student’s t-test was used for comparisons between experimental groups and relevant controlsusing SPSS 13.0 software and P<0.05 was considered a statistically significant difference. Spearmancorrelation analysis was used to examine the inverse correlation of iR-143 expression and B7H1 protein.Results:1. MiR-143 plays an inhibition role in RITL.1.1 The copies of miR-143 in RITL tissues from a gene chip were significantly higher than in normal thymus tissues. Compared to the normal thymus tissues, the expression of miR-143 in RITL tissues detected by RT-PCR were down-regulated in 15 pairs of normal thymus tissues and RITL tissues. It was proved that the expression of miR-143 in RITL tissues was lower than in normal thymus tissues.1.2 The proliferation of NIH3T3 and EL4 cells were inhibited by up-regulation of miR-143, and the more up-regulation of miR-143,the more inhibition of cell proliferation.1.3 Down-regulation of miR-143 by miR-143 ASO in NIH3T3 or EL4 cells could promote cell proliferation detected by MTT.1.4 Cell apoptosis rate was increased with the up-regulation of miR-143, while decreased with down-regulation of miR-143.1.5 EL4 cells with miR-143 up-regulated and normal EL4 cells were injected into the subcutaneoustissue of neck in nude mice to evaluate the effects of miR-143 ontumorigencity. The results showed that over-expression miR-143 could decrease the tumorigenesis rate and tumor volume.2. MiR-143 inhibits RITL by targeting B7H1 with a 3’UTR dependent manner2.1 The expression of PD-L1 was significantly inhibited by up-regulation of miR-143 in the PD-L1 3’UTR with wide-type sequence team, while the expression of PD-L1 was not related to the up-regulation of miR-143 in the PD-L1 3’UTR with mutation sequence team. On the other hand, FACS detection also shows that the expression PD-L1 was significantly inhibited by up-regulation of miR-143.2.2 The apoptosis rate was decreased and the proliferation rate was enhanced in Ad-miR-143 with Ad-B7H1 group, compared to Ad-miR-143 without Ad-B7H1 group. This indicated that PD-L1 expression rescued the effects of promoting apoptosis and inhibiting proliferation of miR-143.3. The high expression of PD-L1 could be induced by radiation and there was a negative correlation between miR-143 and PD-L1.3.1 The BALB/c mouse were divided into 4 teams(0h,12h,24h,48h after 8Gyradiation) The thymus tissues were removed and made into single cell suspension which were detected by FACS for the expression of PD-Ll.The results show that the expression of PD-L1 sharply increased in the next 24h post radiation. The relative expression of PD-L1 was positively relatedwith the time post radiation. The expression of PD-L1 got to a platform instead of continuing increase 24h later.The expression of PD-L1 from thymus tissues 24h after radiation(the dose of the 5teams were OGy,2Gy, 4Gy,6Gy,8Gy)were detected by FACS, and the results show that the relative expression of PD-L1 was positively related with the dose of radiation.3.2 The expression of PD-L1 were detected with antibody labeling by FACS in the normal thymus and RITL tissues which were removed and made into single cell suspension. Compared with the normal thymus tissues, the expression of PD-L1 is significantly increased in RITL tissues.3.3 The level of PD-L1protein, but not RNA, was up-regulated and inversely correlated with miR-143 in split radiation induced lymphoma tissue samples, and the relative PD-L1 protein/PD-L1 RNA level was inversely related with the miR-143 level, indicating that miR-143 inhibited PD-L1 RNA translating into protein.DiscussionWith the widely applied of nuclear energy, the public were seriously threatened by radiation carcinogenesis from ionizing radiation. Up to now, the mechanism of radiation carcinogenesis is still unclear, and still there is no appropriate treatment to protect from Radiation carcinogenesis.With the development of tumor immunity treatment, the negative co-stimulatory factor PD-L1 becomes the research hotspot for the function of regulating the immune state in the period of theoccurrence and developmentof tumor, and mass of miRNAs were located in fragile sites which was correlated with tumor. This suggests that miRNA plays a key role in theoccurrence and developmentof tumor. Rest on the content above, we expect to preliminarily explore the role PD-L1 played in radiation carcinogenesis and find a possible way to protect from radiation carcinogenesis from the angle of miR-143 regulating the immune state by targeting PD-L1.Our study shows that miR-143 was down-regulated in RITL tissues while up-regulation of miR-143 could inhibit cell proliferation and promote cell apoptosis. MiR-143 targets PD-L1 in a 3’UTR-dependent manner. The expression of miR-143 is inversely correlated with the expression of PD-Ll,and up-regulation of miR-143 could inhibit the expression of PD-L1 and protect from radiation carcinogenesis. On the other hand, the expression of PD-L1 could be up-regulated by ionizing radiation and PD-L1 is up-regulated in RITL tissues. Take the critical role PD-L1 played in tumor escape, it indicates that inhibition of PD-L1 maycould protect from radiation carcinogenesis. In short, down-regulation of PD-L1 by up-regulating miR-143 may be a new way to protect from radiation carcinogenesis.