Study On The Application Of DNA Electrochemical Biosensor For Analysis Of Mercury Ion And Thrombin

DNA electrochemical biosensor is a new cross-disciplinary which relates to the field of biochemistry, electrochemistry, medicine, electronics and information technology and so on. A lot of DNA biosensor technologies have been developed based on the specifically complementary pairing of DNA molecules. It is a new life science research method and causes widespread concern in the field of life sciences. The DNA electrochemical biosensor not only has the characteristics of electric analytical chemistry, but also has specific affinity capacity of biomolecule and the ability of specific recognition to target. So, DNA electrochemical biosensors have achieved highly sensitively and selectively detect target molecules. DNA electrochemical biosensor is a simple, reliable, sensitive, rapid, low cost, and good selective sensor. In recent years, it shows broad application prospects in molecules biology, biomedical engineering, environmental monitoring, and food hygiene. It has become the cutting-edge topics of the biology and medicine. Square wave voltammetry (SWV), differential pulse stripping voltammetry (DPV), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) were used to analyze the changes in physical and chemical properties of electroactive substances which were assembled on the surface of the electrode. It realized the analysis and detection of different targets. Three kinds of DNA electrochemical biosensor were developed in this paper. The main work is as follows:Part 1 A sensitive and selective electrochemical biosensor for detection of mercury (II) ions based on nicking endonuclease-assisted signal amplificationThe electrochemical responses of methylene blue are different in the presence and absence of Hg2+. A novel signal amplification method based on methylene blue (MB) and nicking endonuclease (NEase) was developed for Hg2+ detection. In the presence of Hg2+, the loop of Probe A (PA) could hybridize with mismatched probe B through the stable T-Hg2+-T linkage, forming the nicking recognition site, and PA was opened. Then NEase discerned the recognition site and nicked PA in the hybrid duplexes. After the dissociation of PA fragments, MB-labeled pieces dissociated from the Au electrode surface. The released probe B and Hg2+ could be reused to initiate the next cycle and more electroactive indicators dissociated from the electrode surface, resulting in a significant signal decrease. Under optimum conditions, this assay achieved a detection limit of 87 pmol L-1 (S/N= 3) and discriminated other metal ions from Hg2+ with a high selectivity. The biosensor which was constructed by using this method could highly sensitively detect Hg2+Part 2 A label-free and signal-on electrochemical biosensor for detection of mercury(Ⅱ) ions. based on Hg2+-induced formation of G-quadruplex-hemin complexThymine-thymine (T-T) mispairs could selectively capture Hg2+ in aqueous solution to form T-Hg2+-T base pairs in DNA duplexes. In the presence of Hg2+ S2(5’-GGGAGGTGAAAATT GTTGGTTGTTCC-3’) could partially hybridize with mismatched S1(5’-GGAACATCCTTCTTAAAAGGGCAGGG-(CH2)6-SH-3’) through T-Hg2+-T base pairs which triggered the proximity assembly of the guanine-rich nucleic acid. And then hemin and K+ were added to help the split guanine-rich nucleic acid to fold into G-quadruplex-hemin complexes on the electrode surface to produce a remarkable electrochemical response. Under optimum conditions, the calibration curve displayed a good linear relationship between the average DPV peak currents and the logarithm of Hg2+ concentrations in the range from 50 pmol L-1 to 100 nmol L-1. The detection limit of the biosensor is 35 pmol L-1. This electrochemical biosensor which was used to detect Hg2+ has sensitive electrochemical response, good stability and reproducibility, simple operation and low cost. It has been successfully applied to detect the trace amounts of mercury ions in water samples.Part 3 A sensitive electrochemical biosensor for detection of thrombin based on G-quadruplex-hemin complex and HCR signal amplification technologyA.sensitive electrochemical biosensor for thrombin has been developed by using the specific recognition between thrombin and thrombin aptamer. In the presence of thrombin, S1 (5’-GGTTGGTGTGGTTGGTTTTTTTTTTTTTTTCTAGACCGTCTGC C-3’) and S2(5’-CAGACGGTCTAGTTTTTTTTTTTTTTTAGTCCGTGGTAGGGC AGGTTGGGGT GACT-3’) can combine thrombin to form a sandwich structure. This sandwich structure has a strong stability. So(5’-HS-(CH2)6-TTTTTGGCAG ACGGTCTAGCTTTA-3’), S1 and SO can dissociate to form a sandwich structure from the electrode surface. At last, only single chain SO was on the gold electrode. Then, this electrode was immersed in the mixed solution of H1(5’-AGGGCGGGTGGG TCTAGCTTTTGGAGAAGTGTAAAGCTAGACCGTCTGCCTGGGT-3’) and H2(5’-TGGGTCACTTCTCCAAAAGCTAGTGGCAGACGGTCTAGCTTTTGGGTAGGG CGGG-3’), SO can effectively open haipin H1, and the opened H1 can induce hybridization chain reaction of H1 and H2. After reaction, the DNA sequences of split G-quadruplex can close to each other. Under the help of hemin and K+, a large number of G-quadruplex-hemin was formed on the electrode. A lable-free, simple, and signal-on electrochemical biosensor can quantitative detect thrombin. Under optimum conditions, the calibration curve displayed a good linear relationship between the average DPV peak currents and the logarithm of thrombin concentrations in the range from 5 pmol L-1 to 5 nmol L-1. The detection limit of the biosensor is 2.9 pmol L-1.