Rapid Detection Of Human Cytomegalovirus PP65Antigen Based On Aptamer-functionalized Magnetic Beads

Background:Human cytomegalovirus (HCMV) is the human herpes virus5, belong to the betaherpesvirus family. The human is only host of HCMV. HCMV spreads widely among thepopulation in the world with the infection rate of50%to90%. Most of people infected byHCMV are asymptomatic with the latent virus in the host cell for long time. HCMVcommonly causes the active infection in pregnant women and the congenital infection infetus, resulting in the miscarriage or neonatal retardation, etc. The latent virus could bereactivated and proliferated to cause the serious infection, high morbidity and mortality inthe specific crowds with immature or impaired or repressed immune system. To date, thereis no effective vaccine to HCMV and the treatment of patients actively infected by HCMVjust rely on limited antiviral drugs. In recent years, the infected problem of HCMVdrug-resistant strains becomes increasingly outstanding. Therefore, establishment of areliable method for early diagnosis is the key for the effective prevention and cure ofHCMV infection.Recent researchs show that some envelope proteins of HCMV play important roles inwhole life cycle, including viral invasion, gene expression, immune evasion, viral assemblyand egress. The accurate detection of these envelope proteins of HCMV could be used toearly diagnose HCMV active infection and guide rational use of drugs in clinical treatment.Among them, PP65is the most abundant envelope protein and the important component ofthe extracellular virus particles. Now, PP65antigen is the preferred diagnostic biomarkerfor the active infection and emerging infection of HCMV in clinical laboratory.Immunofluorescence assay (IFA) is common method for the detection of HCMV PP65antigen, based on intact leukocytes in blood as a detection carrier, with a high demands ofthe leukocyte number and morphology, which is only suitable for blood samples, notsuitable for the blood samples from marrow transplant and immunosuppression or immunedeficiency patients with granulocytopenia, and other body fluids, including cerebrospinal fluid, urine, amniotic fluid. In addition, IFA involves the separation of leukocytes andincubation of multiple antibodies with disadvantages of tedious procedure, time-consuming,high cost.Aptamer is single-stranded oligonucleotides (ssDNA) screened from the large volumeof synthetic combinatorial libraries of single-stranded oligonucleotides by SystematicEvolution of Ligands by EXponential enrichment (SELEX) technology. Oligonucleotideaptamers could independently form specific secondary or tertiary space structure under theoptimal condition for binding to their targets with higher affinity and specificity. ssDNAaptamers have advantages of wide target molecules, easy synthesis and modification invitro, and stablity, easy storage, high purity, little batch difference, low cost, etc. Therefore,aptamer is a good kind of candidate molecule to replace antibody and widely used in thearea of disease diagnosis, new drug screening and targeting drug-delivery.Magnetic beads are micro-nano magnetic particles with superparamagnetism, goodbiocompatibility, high dispersibility and stability. Magnetic beads could be functionalizedby modifying different active functional groups on their surface for recognition andenrichment of the trace target molecules in complex samples, and used as the solid phasecarrier of trace soluble substances for the separation of trace substances, bioassay, samplepreparation, targeting drug-delivery.This study aimed at the problems of HCMV PP65antigen detection in clinicallaboratory. HCMV PP65protein was used as target to screen aptamers with specificity andhigh affinity from the large volume of ssDNA synthetic combinatorial libraries by SELEX.The aptamer were immobilized on magnetic beads to prepare aptamer-functionalizedmagnetic beads for recognization and enrichment of the soluble PP65antigen in urinesamples. The fluorescence labeled antibody was used to trace the compounds of antigen andantibody. A novel sandwich immunofluorescence assay based on aptamer-functionalizedmagnetic beads was established for the detection of HCMV PP65antigen in urine and torealize specific, sensitive and rapid detection of free HCMV PP65antigen in urine, bloodand other samples, which broadened clinical application fields of HCMV PP65antigen, andhad an important clinical application value in early diagnosis of HCMV active infection.Objective:To screen ssDNA aptamer to HCMV pp65antigen with high affinity and specificity bySELEX technology and prepare aptamer-functionalized magnetic beads to preliminarily establish a novel method of sandwich immunofluorescence assay based on aptamer-functionalized magnetic beads for the detection of HCMV PP65antigen.Methods:1. Screening of aptamerA78nucleotides single-stranded oligonucleotides library with the capability of1015-1016, consisting of a random sequence of35nucleotides and two known end sequences,was established to screen aptamer. The saturated ssDNA library against PP65antigen wasobtained by8cycles of SELEX. To remove nonspecific ssDNA sequences and ensure thespecificity of the saturated ssDNA library, the blank as reverse selection in the first3cyclesand GST tag protein of recombination HCMV PP65antigen as reverse selection in the later5cycles were run.2. Structure analysis and activity identification of aptamerThe saturated ssDNA library was cloned and sequenced. The secondary structures ofaptamers were analyzed and predicted by the DNAMAN software and the affinity to thePP65antigen was determined by ELISA.3. Preparation and optimization of aptamer-functionalized magnetic beadsThe aptamer A4with the highest affinity to PP65was modified and coupled on thesurface of magnetic beads by EDC to prepare the aptamer-functionalized magnetic beads.Then, the coupling proportion of aptamer and magnetic beads, EDC concentrationand coupling time were respectively disscussed to optimize the preparation conditions ofthe aptamer-functionalized magnetic beads.4. Establishment and the detection conditions optimization of sandwich immuno-fluorescence assay based on aptamer-functionalized magnetic beadsThe aptamer-functionalized magnetic beads, used to specifically capture and enrichHCMV PP65antigen in solution, and the FITC labeling monoclonal antibody of HCMVPP65antigen as the tracer were intergrated to establish a new sandwich immune-fluorescence assay based on aptamer-functionalized magnetic beads and antigen andfluorescence labeling monoclonal antibody for the detection of PP65antigen in urine. Thefluorescence results were observed by fluorescence microscope. At the same time, effectsof different incubation time of aptamer and PP65antigen, PP65antigen and monoclonalantibody on the results were discussed to establish appropriate detection conditions.5. Detection of clinical samples and compare with PCRPP65antigen in urine supernatant and urine sediment lysates, from40suspicious children actively infected by HCMV, were determined respectively by the sandwichimmunofluorescence assay based on aptamer-functionalized magnetic beads. At the sametime, HCMV DNA in urine sediment was determined by the fluorescent quantitative PCR.The results of two methods were qualitatively compared for identification of the accuracyand feasibility of the new method in clinical baboratory. The detectable limit andrepeatability of this method were preliminarily discussed.Results:1. The saturated ssDNA library to HCMV PP65antigen was obtained by8cycles ofSELEX. Ultimately, six aptamers with high affinity and specificity to HCMV PP65antigenwere identified by cloning and sequencing, and respectively named as aptamer A4, A5, A6,A7, A10, A19.2. The secondary structures of six aptamers were analyzed and predicted by theDNAMAN software. The results showed that all of them formed one or more pocket andstem-loops like structures, which suggested that the aptamers had the spatial structurebinding to PP65antigen. The affinities of aptamer A4, A5, A6, A7, A10, A19to PP65antigen were detected by ELISA. The OD values of the affinity assay were distributed on1.137to2.726, revealing that affinities of the six aptamers were higher. Among them, theaptamer A4had the highest affinity with the OD value of2.726. So aptamer A4was thebest one, and could be used as a specific recognization molecule to HCMV PP65antigenwith higher affinity.3. The aptamer A4(GGGAGCTCAGAATAAACGCTCAAGGCATGGTCCTCGATC-GTATGGCTTTGCGGTCGTGTTCGACATGAGGCCCGGATC), as a optimal specificrecognition molecule to HCMV PP65antigen was modified (5’-HEX-TTTTTGGGAGCTCAGAATAAACGCTCAAGGCATGGTCCTCGATCGTATGGCTTTGCGGTCGTGTTCGA-CATGAGGCCCGGATCAAAAAAA-NH2C7-3’) and coupled on the surface of themagnetic beads by EDC. On the photos by Fluorescence microscopy, clear red fluorescencewas on the surface of the aptamer-functionalized magnetic beads, indicating that theaptamers were modified successfully on magnetic bead surface, and the aptamer-functionalized magnetic beads could be used to specific recognize and enrich PP65antigen.In addition, the optimal aptamer-functionalized magnetic beads could be constituted underthe condition of0.5μL of carboxyl modified magnetic beads (25mg/mL) and2.5μL aptamer(1μmoL/L) in the MES coupling buffer with EDC（0.5g/L）.4. The sandwich immunofluorescence assay, based on aptamer-functionalized magnetic beads and fluorescence labeling monoclonal antibody, was eatablished for thedetection of HCMV PP65antigen. The photos showed that specific green fluorescent wereon the surface of part magnetic beads in experimental group, and their positions of greenfluorescence and red fluorescence were matched with magnetic beads, which showed theaptamer-functionalized magnetic beads could effectively capture PP65antigen in thesample without nonspecific binding with fluorescence labeling monoclonal antibodies.Under the optimized detection conditions, HCMV PP65antigen were effectively capturedwith the the incubation time of1h and the compounds of PP65antigen the fluorescencelabeling monoclonal antibody to HCMV PP65antigen were traced for another1.5h.5. The free HCMV PP65antigen in40urine supernatant and40urine sediment lysatesfrom the suspicious children actively infected by HCMV were respectively determined bythe sandwich immunofluorescence assay based on the aptamer functionalized magneticbeads. HCMV DNA levels in40urine sediment samples were analyzed by quantitativePCR. The results by new sandwich immunofluorescence assay were qualitatively comparedwith that by PCR, which showed that the positive coincidence rate was75.9%in urinesupernatant and96.6%in urine sediment respectively, and the negative coincidence rateswere100%in urine supernatant and urine sediment lysates. The results suggested the newmethod in this study could be used to detect the HCMV PP65antigen in the urine,especially in the urine sediment.Conclusion:1. The aptamers to HCMV PP65antigen with higher affinity and specificity wereobtained successfully as specific recognition molecules to establish the novel method forthe detection of HCMV PP65antigen.2. The aptamer-functionalized magnetic beads were prepared and optimized as specificrecognition molecules and detection carrier for enrichment of the free HCMV PP65antigen in complex samples such as urine.3. The new sandwich immunofluorescence assay based on the aptamer-functionalizedmagnetic beads had been successfully established to detect HCMV PP65antigen in urine.Results compared with PCR, showed the coincidence rate was high and specificity was100%between two methods. The sandwich immunofluorescence assay based on theaptamer-functionalized magnetic beads was a simple, rapid, accurate and cheap method forthe detection of HCMV PP65antigen in clinical laboratory.