Font Size: a A A

The Auto-regulatory Negative Feedback Loop Between B-raf\ERK Pathway And Mpsl,and Its Abrogation By Oncogenic B-RafV600E In Melanoma Cells

Posted on:2015-01-19Degree:MasterType:Thesis
Country:ChinaCandidate:C T HeFull Text:PDF
GTID:2254330431961771Subject:Cell biology
Abstract/Summary:
Background MAPKs signaling pathway presents in most cells and has crucial roles in cell growth, proliferation, differentiation and apoptosis. The RAS-RAF-MEK-ERK signaling involves in activating multiple oncogenes and plays important role in tumorigenesis. The B-RAF mutations have been found in many human cancers, such as70%of melanoma,50%of thyroid carcinoma. The V600E mutation accounts for at least90%of all B-RAF mutations. Dr Cui identified a new target of oncogenic B-RAFv600E——Mpsl. Phosphorylation of Mps1by BRAFV600E signaling strengthens the stability of Mpsl protein contributing to centrosome amplification, activation of the spindle checkpoint and activation of the spindle checkpoint. However, the molecular mechanism through which B-RAFv600E regulating the expression of Mpsl protein in melanoma cells is poorly understood.Objective To validate the molecular mechanism through which B-RAF regulates Mpsl protein level in melanoma cells.Methods (1) We constructed four kinds of plasmid (pBabe-puro-GFP-Mps1-WT pBabe-puro-GFP-Mpsl-KD,pBabe-puro-GST-B-RafWT,pBabe-puroGST-B-RafV600E) and transfected into HEK293T cells to prepare retroviral vectors by standard calcium phosphate precipitation.Then use retroviral vectors to infecte different kinds of human melanoma cell lines.(2)We designed two oligo short interfering RNAs (siRNAs) against human B-Raf specific sequences at exon11(BE11, AAAGAATTGGATCTGGATCAT) or exon3(BE3, AAGCTAGATGCACTCCAACAA) and transfected into cells with Lip2000.(3) Use pSUPER.retro-siMpsl to knock down Mpsl in different melanoma cell lines.(4)48h post transfection, Western blotting was performed with a monoclonal Nl anti-Mpsl antibody or B-Raf polyclonal antibody or phospho-p44/42MAPK (Thr202/tyr204, E10) monoclonal antibody to detect Mpsl or B-Raf or p-ERK expression.Results (1) Inhibiting B-Raf and MEK led to a dramatic reduction of Mpsl protein levels in both B-RafWT and B-RafV600E cells, suggestting that B-Raf\ERK pathway is required for maintaining the Mps1levels in melanoma cells.(2) Exogenous expression of Mpsl negatively inhibits B-Raf\ERK pathway in B-RafWT melanoma cell lines while knockdown of endogenous Mps1leads to enhanced B-Raf\ERK signaling in B-RafWT. These results reveal that a novel autoregulatory negative feedback loop exists between Mpsl and B-Raf\ERK signaling in human melanoma cells harboring B-RafWT genotype.(3) Expression exogenous either Mpsl-WT or Mpsl-KD does not affect the feedback loop, indicating that Mpsl kinase activity is not required for the auto-regulatory negative feedback loop between Mpsl and the B-RafWT\ERK pathway.(4)Exogenous expression of Mps1or knockdown of endogenous Mps1led no change on the activity of B-Raf\ERK pathway in B-Rafv600E melanoma cell lines. These results suggest that oncogenic B-Rafv600E shows resistance to the auto-regulatory negative feedback loop.Conclusion Based on our findings, we propose that there exists an auto-regulatory negative feedback loop between the Mps1kinase and B-RafWT\ERK signaling and the loop is independent of Mpsl kinase activity. Oncogenic B-Rafv600E abrogates the regulatory negative feedback loop of Mpsl on the MAPK pathway.
Keywords/Search Tags:Melanoma, B-Raf\ERK signaling, Mpsl, Negative feedback, B-RafV600E
Related items