Font Size: a A A

Relationship Between XPA A23G And Xpg His1104Asp Polymorphism And Risk Of Lung Cancer

Posted on:2014-03-01Degree:MasterType:Thesis
Country:ChinaCandidate:H CengFull Text:PDF
GTID:2254330401489779Subject:Internal Medicine
Abstract/Summary:
Objective: Various DNA alterations can be caused by exposure toenvironmental and endogenous carcinogens. Most of these alterations, if notrepaired, can result in genetic instability, mutagenesis and cell death. DNArepair mechanisms are important for maintaining DNA integrity and preventingcarcinogenesis. Genetic variations in DNA repair genes are thought to modulateDNA repair capacity and are suggested to be related to malignant tumor risk.Xeroderma pigmentosum group A (XPA) and xeroderma pigmentosum group G(XPG) are core genes of nucleotide excision repair (NER) pathway in DNArepair system.The purpose of this study is to investigate the relationship betweensingle nucleotide polymorphisms (SNP) of XPA and XPG gene and risk oflung cancer, and to provide theory basis for susceptible individuals of lungcancer.Methods: Case–control study was performed in139patients with lungcancer and133healthy controls. DNA in peripheral blood was obtained, andpolymerase chain reaction–restriction fragment length polymorphism(PCR–RFLP) was employed to determine the genotype distribution of XPA A23Gand XPG His1104Asp. The PCR primers for the XPA A23G polymorphismwere: forward5’–GCGCAGGTGCTCTCACTCAGAAAG–3’, and reverse 5’–CTCTAAAGCCGCCGCCTCCGTCAAAG–3’. The PCR primers for theXPG His1104Asp polymorphism were: forward5′–GACCTGCCTCTCAGAATCAT–3′, and reverse5′–CCTCGCACGTCTTAGTTT–3′. The PCR reaction was performed in a25μLreaction volume: template DNA3μL, forward and reverse primers each0.5μL,2×Master Mix(pfu DNA polymerase0.05U/μL, MgCl24mmol/L, dNTPs0.4mmol/L)12.5μL. Conditions for XPA A23G gene PCR were an initialdenaturation at95℃for5min, followed by35cycles at94℃for30s,61℃for30s (annealing temperature),72℃for45s, and ending with72℃for7min. Conditions for XPG His1104Asp gene PCR were an initial denaturationat95℃for5min, followed by35cycles at94℃for30s,55℃for30s(annealing temperature),72℃for45s, and ending with72℃for7min. ThePCR products were incubated at37℃in a water thermostat for5min with1μL of the restriction enzyme Fast Digest Msp I (Fermentas,#FD0544) or FastDigest Nla III (Fermentas,#FD1834). The restriction fragments were thenvisualized by4%agarose gel electrophoresis, with ethidium bromide staining.Three types of band patterns were obtained, XPA A23G gene: will typehomozygote (A/A), only one band with175bp; heterozygote (A/G), threebands corresponding to175bp,127bp and48bp; and polymorphic homozygote(G/G), two bands corresponding to127bp and48bp. XPG His1104Asp gene:will type homozygote (His/His), two bands corresponding to227bp and44bp;heterozygote (His/Asp), three bands corresponding to271bp,227bp and44bp;and polymorphic homozygote (Asp/Asp), only one band with271bp. Statisticalanalysis: Analysis of data was performed using the computer software StatisticalPackage for Social Sciences (SPSS) for Windows (version17.0). Theχ2testwas used to compare among groups of categoric variables and the Hardy– Weinberg equilibriums of SNP. Association between SNP and lung cancer riskwere estimated using the logistic regression models. A two–tailed p<0.05wasconsidered statistically significant.Results:(1) There were no statistically significant differences in the sexand age distribution between lung cancer group and control group(P>0.05),The cases showed a higher prevalence of smokers compared with the controls(P=0.038).(2)There was no significant difference in genotype distribution ofXPA A23G between lung cancer group and control group(P=0.820).(3) Therewas a significant difference in genotype distribution of XPG His1104Aspbetween lung cancer group and control group(P=0.004),His/Asp,Asp/Asp andcombined His/Asp and Asp/Asp genotype significantly increased risk of lungcancer [adjusted odds ratios (OR)=3.05,95%confidence interval (CI)=1.51~6.16, P=0.002;adjusted OR=2.93,95%CI=1.38~6.22, P=0.005; adjustedOR=3.01,95%CI=1.54~5.87, P=0.001, respectively] compared to the His/Hisgenotype.Conclusion: There may be no relationship between XPA A23G variantsand lung cancer risk,while XPG His1104Asp polymorphism may contribute togenetic susceptibility to lung cancer and the Asp allele may be a risk factor inthe development of lung cancer.
Keywords/Search Tags:gene polymorphism, lung cancer, susceptibility, xerodermapigmentosum group A polymorphism, xeroderma pigmentosum group Gpolymorphism
Related items