Studies On RRS1Gene Of Bacterial Wilt Resistance From Arabidopsis In Tobacco For Homolog

It is aimed to study and help to select the germplasm of the resistance gene of thetobacco ralstonia solanacearum in RRS1gene. The investigation and selection werecarried out in2008,2009and2011.Eighty tobacco germplasm resources chosen arefrom Zimbabwe and some other countries. The investigation to the index ofralstonia solanacearum infected in tobacco field were finished. And the RRS1geneand nine pairs of specific primers were selected too. Through the selection, primer6F-6R(5′ATGAGAAAGAGGCTCGTCAA3′and5′ACCACAACCCTCAAGCAGTT3′) is sure to filter the available germplasm. Three germplasms of tobacco arechosen which contain the specific amplified sequence RRS1.They are G28,K346andLMAFC34.It is expected to do the job of the sequencing to the three tobaccogermplasms. And at the same time to contrast the homology of the DNA with RRS1gene and analyse the homology.1.In tobacco germplasm there is no reported bacterial wilt resistance gene that canbe used directly. RRS1gene in arabidopsis cloning is the first bacterial wilt resistancegene that is found. Currently, research is only limited in Arabidopsis without selectingsimilar genes in other crops. This research is to conduct a screening study in tobaccogermplasm’s bacterial wilt resistance genes in order to find similar resistance genes intobacco germplasm and realize the improvement in breed and breed resistance in theend.2.138tobacco germplasm, including26with identified resistance to tobaccobacterial wilt, were identified and class-ified on their resistance to bacterial wilt ingeneral randomized block design and high density planting technique in diseased fieldin Anhui province in2008and2009.For groups were classified according to changeof disease index in the whole growth duration after transplanting, i. e. immune type,suscept ible type, rate-reducing resistance type and resistance type. No immune typewas found.3variet ies were classified as resistance type, which were Coker298,NC86, and Sheyuan4116variet ies were rate-reducing resistance type and otherswere susceptible type.3.This research select3kinds of tobacco germplasm (G28、K346、LMAFC34)after adding80tobacco germplasm in specific primers. PCR amplification carries thespecific fragments of the same molecular weight size as arabidopsis, which caneffectively screen bacterial wilt resistance genes. By using PCR amplification toidentify germplasm without limit of environment and time, it is possible to re-validate the reliability of the results4. DNAs of population were extracted to develop into a resistant pool and asensitive pool based on the BSA. By SSR,286random primers were used to amplifythe two gene pools. primer PT20275and PT30229were found.By using PT20275primer, it is possible to amplify specific band of the size of380bp. Or by usingPT30229primer, it is possible to amplify specific band of the size of200bp. Thesecan be used to judge its resistance.