Generation Of Fibroin Heavy Chain Knockout Silkworm And Its Application

Silkworm is renowned both inside and outside the country because of its strong secretion of silk spinning ability,which made an important contribution to the economic and cultural exchanges in the world.Silk fiber is an aggregation of microfiber protein complex, which has good luster, hue, handle and in the hygroscopicity, inspiratory, compatibility with many excellent properties of skin.However, silk fiber has some shortcomings,for example not wear-resisting, easy to yellow fade, and strength not as good as spider silk fiber.So how to transform the silk,and obtain high strength strong extensibility, easy dyeing, high skin affinity quality performance has been a research problem.The silkworm as a result of thousands of years of breeding out of the ordinary method, whose silk properties has been very difficult to change, and the highly repetitive sequence high molecular weight and high expression of silk fibroin heavy chain makes the use of transgenic technology routine is difficult to study and reform. The development of zinc finger nuclease (zinc finger nuclease, ZFN) technology in recent years, because of its specific recognition targeting DNA gene sequences, and the ability of cause the DNA double strand break (DSB) and stimulate the body’s own repair pathways.There are two repair pathways,which is homologous recombination (Homologous recombination, HR) and non-homologous end link (Non-homologous end joining, NHEJ).By the two ways to achieve targeted gene knockout and knockin.At present, this technology has been widely used in animal and plant gene knockout and site-directed transformation.Therefore, the zinc finger nucleases technology is good pathway, which could achive site-directed transformation our silk protein gene and rapidly obtain silk protein mutant resources.In this study, we choose silk fibroin heavy chain gene as a target and select polyvoltine silkworm variety "N4" and diapause of Silkworm Variety "Dazao" for microinjection materials, and nusing a newly developed zinc finger nucleases technology to high efficiency knockout of fibroin heavy chain gene. We first obtained a series of mutant strains of silkworm,what is the deletion, mutation or some small fragments of inserted the non-repeat region of fibroin heavy chain gene N end. And finished the sequencing analysis, the observed of mutation phenotype silk gland and compared with the wild type silkworm cocoon. We high expressing green fluorescent protein in the mutant strains of silkworm. By this study, we found a useful reference for the use of silk gland as the bioreactor to express foreign proteins.The main results:(1). According to the analysis of sequence characteristics of the fibroin heavy chain gene, zhe different of silkworm strains SNP distribution, and the combination of zinc finger protein identification characteristics of DNA sequences, we choose CTGTT-GCTCAAA GTTATGTTGCTGCTGATGCGGGAGCA as the zinc finger nuclease recognition of target sites, the sequences of the target sites are located such as SEQ ID NO:1shown in the+1325～+1362. We designed and synthesis of the fibroin heavy chain gene targeted knockout zinc finger nuclease carrier.(2). The synthesized FibH-ZFN mRNA were injected into the polyvoltine silkworm variety "N4" and diapause of Silkworm "Dazao". We obtain250and105mutants from G1generation’s29and38moth ring, which phenotype appeared naked pupa cocoon layer sericin or thin.(3). We were sequenced from the screening of the117mutants, which phenotypes were naked pupa or "sericin cocoon" mutation.The results of sequencing showed that the117mutation individuals were mutated in the zinc finger nuclease target sites, the specific sequence of SEQ ID NO:2-118, these mutations including mutation, deletion and insertion fragment.(4). Anatomy the silk gland of silkworm mutant and wild-type silkworm and observe them, we found that mutant line of silk gland were significantly lower in the silk gland, followed by its silk glands are degenerated. Compare their cocoon silk, we found mutant strains thickness and cocoon layer weight are smaller than the wild type; by protein electrophoresis of cocoon filament component analysis, we found that mutant line of silk does not contain fibroin protein, only the sericin protein.(5). Construction of fusion of the fibroin heavy chain gene non-repetitive regions of the GFP transgenic vector, insert it into the fibroin heavy chain mutant lines. By detecting the protein levels, found its expression level is higher than that of the wild type for the transgenic silkworm materials, it is also our silk fibroin heavy chain mutant strains as the feasibility strain on the basis of silk gland bioreactor.