| 1. IntroductionMore than half of all proteins are glycoproteins, and the structures of glycoproteins affect their functions. Glycosyltransferase, located in the Golgi apparatus, plays an important role in the structure of glycoproteins. It contains at least six N-acetylglucosaminyltransferases (GnTs), named as GnT-I-VI. Glycosyltransferase-V is recognized as a major member of glycosyltransferase family, catalyzing (31-6 branching of N-acetylglucosamine on asparagine (N)-linked oligosaccharides (N-glycan) of cell surface proteins. A variety of studies have showed that increases inβ1,6 branched N-glycan structures are related to malignancy in many tumors, such as uveal melanoma and gastric cancer. Saito Takashi also found that secreted GnT-V protein could result in tumor angiogenesis, and its mechanism as an inducer of angiogenesis was different from its original function as a glycosyltransferase. Although most of the studies showed GnT-V was positi V ely correlated with malignancy in many tumor cells, such as breast cancer, human colon cancer and human fibrosarcoma, Dosaka-Akita reported that low GnT-V expression was associated with short survival and poor prognosis in pStage I non-small cell lung cancer. Obviously, there are conflicts about the role of GnT-V in the malignancy of different tumors.Nasopharyngeal carcinoma (NPC) is a common cancer in Southeast Asia, especially in south China. Local recurrences and distant metastasis often occurs in 30-40% of NPC patients at advanced stages. Factors associated with NPC malignancy are complex, and include environmental factors, Epstein-Barr virus infection, and molecular alterations such as Bmi-1 and matrix metalloproteinase-19. Histologically, NPC is usually classified into three types:WHO I, II and III. WHO Type III accounts for more than 97%, which is mostly treated by radiotherapy. While radiation has always been the main treatment choice for NPC, it sometimes fails to be effective, because tumors cells may be resistant to radiation. Some biomarkers for radio sensitivity include Raf kinase inhibitory protein, GRP78, and p53 gene. However, a reliable and con Venient biomarker for NPC radio sensitivity has not been identified.Although previous studies showed GnT-V maybe associated with malignancy in many tumors, the relationship between GnT-V and NPC has not been reported. To investigate this relationship, the GnT-V stably suppressed cell line was constructed (CNE-2 GnT-V/2224) from CNE-2. In this study we investigated whether GnT-V affects malignancy both in vitro and in vivo. The characteristics of NPC cell adhesion to vascular endothelium cells were analyzed under flowing conditions, using a parallel plate flow chamber. Especially, relationships between GnT-V and radiosensitivity, and possible mechanisms affecting NPC malignancy and radio sensitivity, were also researched.2. Materials and methods2.1. Cell culture and transfectionHuman poorly differentiated nasopharyngeal carcinoma cell line, CNE-2 was provided by the cell bank of Sun Yat-Sen University. The cells were cultured at 37℃, 5% CO2 in RPMI-1640 medium containing 10% new bovine serum, penicillin and streptomycin. EA.hy926 (CRL-2922, ATCC) cells were cultured at 37℃,5% CO2 in DMEM containing 10% fetal bovine serum, penicillin and streptomycin.The pGPU6/GFP/Neo vector was obtained from Shanghai GenePharma Co, Ltd. The pGPU6/GFP/Neo GnT-V/1564 (plasmid of antisense GnT-V cDNA), pGPU6/GFP/Neo GnT-V/2224 (plasmid of antisense GnT-V cDNA) and pGPU6/GFP/Neo GnT-Ⅴ/NC (control plasmid) were constructed as described previously. All of the constructed plasmids were transfected into CNE-2 cells by Lipofectamine 2000 (Invitrogen, California, USA). The oligofectamine reagent was composed of 0.5μg/ul plasmids 2 ul, Lipofectamine 2000 2μl and Opti-MEM 96ul. Stable transfects were selected for one month under G418 (2 mg/ml), and named as CNE-2 GnT-Ⅴ/1564, CNE-2 GnT-Ⅴ/2224, and CNE-2 GnT-Ⅴ/NC, respectiⅤely. The pGPU6/GFP/Neo GnT-Ⅴ/2224 reduced GnT-Ⅴexpression more efficiently than pGPU6/GFP/Neo GnT-Ⅴ/1564, so we chose CNE-2 GnT-Ⅴ/2224 for further assays.Levels of GnT-ⅤmRNA were detected by Quantity Real Time Reverse Transcription-PCR analysis (qRT-PCR). Reverse transcription reactions were proceeded for 15min at 37℃, followed by 5s at 85℃for complementary DNA (cDNA) synthesis. Real time reactions were performed using the SYBR(?) PrimeScriptTM RT-PCR Kit (Takara Biotechnology Co, Ltd) under the following conditions:30 s at 95℃for 1 cycle,5 s at 95℃,20 s at 60℃for 40 cycles,95℃for 0 s,65℃for 15 s, and 95℃for 0 s for melting curve analysis. The PCR primers (Shanghai Sangon Biotech Co Ltd) were as follows: GnT-ⅤF: 5' GAGCAGATCCTGGACCTCAG3'; R:5'GCTGTCATGACTCCAGCGTA3';β-actin F: 5'GAAACTACCTTCAACTCCATC 3'; R: 5 CGAGGCCAGGATGGAGCCGCC 3'.The relative mRNA expression level of GnT-Ⅴin each sample was calculated using the comparatiⅤe expression level 2-AACt method.Expression of GnT-Ⅴprotein was detected by western blot assay. Cells (107) were harvested and lysed. Protein concentration of the supernatant was determined by the BCA protein assay procedure. Protein (20μg) was boiled for 5 min, electrophoresed on an 8% polyacrylamide gel, and then transferred to a polyvinylidene difluoride membrane using semi-dry transfer apparatus. After being blocked with 3% BSA +7% fat-free dry milk, the membrane was treated for 2 h at room temperature with primary antibodies(1:200-diluted antibody of GnT-V,1:200-diluted antibody of E-cadherin, and 1:300-diluted antibody of bcl-2, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubation with horseradish peroxidase-labeled secondary antibody (Beijing Biosynthesis Biotechnology Co. Ltd) for 45 min at room temperature, and then stained with ECL reagent. Protein bands were also quantified by Quantity One.2.2. Cell proliferation assayCells were seeded in 96-well plates at 2x103 cells/well. At the indicated times (0 h,24 h,48 h,72 h, and 96 h),10μl cck-8 and 100μl RPMI1640 were added to each well. The cells were incubated with for 60 minutes; absorbance at 450 nm was measured to calculate cell growth rates. Growth rate= (absorbance at 450 nm at x h-absorbance at 450 nm at 0 h)/(absorbance at 450 nm at 0 h)2.3. Cell wound healing assayCells were seeded on 24-well plates and grown to monolayers. Wound areas were scraped using 100-μl plastic tips. At the indicated times (0 h,12 h,24 h), wound areas were photographed and the wound healing rate was calculated. Healing rate= (width of wound at x h-the width of the wound at 0 h)/ width of wound at 0 h.2.4. Cell in Vasion assayUsing 24-well transwell units with 8μm pore size polycarbonate inserts, matrigel (50μl) as a basement membrane was spread on the polycarbonate membrane and allowed to solidify for 1 h at room temperature. Cells that were suspended in RPMI1640 containing 5 g/L BSA were added to each upper compartment of the transwell units. After being cultured for 48 h, cells migrating through the matrigel-coated polycarbonate membrane were fixed by paraformaldehyde, stained with crystal violet and counted in fi V e different fields, selected randomly.2.5. Cell heterogeneous adhesion assayThe 96-well plate was coated with matrigel and blocked by lOg/L degenerated BSA at 37℃for 60 min as experimental group. The 96-well plate coated directly by lOg/L degenerated BSA without matrigel was as control group. Cells were seeded into each matrigel-coated or without matrigel-coated well at 5×104cells/well. Absorbance at 450 nm was measured after cells were incubated with 10μl cck-8 and 100 ul RPMI1640 for 60 min. The adhesion rate= (absorbance at 450 nm of experimental group/absorbance at 450 nm of control group-1)%.2.6. Parallel plate flow chamberThe bottom of the chamber was a 35-mm culture plate with cultured IL-1-activated vascular endothelial cell EA.hy926. The superior surface of the chamber was a flat surface machined from polymethylmethacrylate. The 35-mm culture plate and the flat surface were separated by a 0.2mm thick silicon rubber gasket, leaving a flow chamber (20mm×2.5mm×0.2mm). Test tube filled with cells suspensions was connected with an inlet of the chamber. A uniform fluid flow of cell suspensions was maintained by a standard syringe pump (Fresenius, Bad Homburg, Germany), which was connected to an outlet of the chamber.106/ml cells were pumped from a test tube through the chamber at 0.25 dyn/cm2 wall shear stress. After 5 min perfusion, results were recorded with a MC1310 camera (Mikrotron, Unterschleissheim, Germany). Cells not firmly attached to the surface of EA.hy926, such as rolling cells and cells flowing in the suspension, were not visible on the image, and only firmly attached cells were shown. FiVe visual fields were chosen randomly to count the numbers of CNE-2 GnT-V/NC and CNE-2 GnT-V/2224 cells adhering to EA.hy926. One cell aggregates scored one cell.2.7. Cell radiosensiti Vity assayCells were seeded into 6-well plates dispersedly, at 200 cells/well. Cells were irradiated with 4 single radiation doses (2,4,6, and 8 Gy) using X-ray irradiation equipment (Clinac 2300C/D; varian, United States). Exposed 6-well plates were incubated for 2 weeks, at 37℃,5% CO2. Eventually, the colonies were fixed with 4% paraformaldehyde, stained with 3% crystal violet and counted. The colony-forming rate=the numbers of colonies at 0 Gy/the numbers of cells seeded at 0 Gy. Survival fraction (SF)=the numbers of colonies at x Gy/(the numbers of cells seeded at x Gy×colony-forming rate). The sensitization enhancement ratio (SER)=SF at 2 Gy before suppression of GnT-V/SF at 2 Gy after suppression of GnT-V. 2.8. Cell apoptosis and cell cycleCells were fixed, dehydrated and embedded in paraffin. Subsequently, the detection of apoptosis was proceeded by TdT-mediated dUTP nick end labeling (TUNEL) assay according to the manufacturer's instructions (in situ cell death detection-POD Kit, Roche, Mannheim, Germany). Apoptotic cells are brown. The numbers of brown cells were counted in five different fields, selected randomly.Cells were har Vested, washed with phosphate buffered saline (PBS), and resuspended in binding buffer containing 7-AAD for 10 minutes, followed by addition of Annexin V-PE. Cell apoptosis analysis was carried out using flow cytometer (BD Biosciences, Oxford, United Kingdom). Cells were harvested and fixed in 70% ethanol. After being washed with PBS, the cells were treated with PBS containing RNase. Next,50μg/ml PI was added for 10 min at 37℃followed by flow cytometry analysis of cell cycle (BD Biosciences, Oxford, United Kingdom).2.10. Statistical analysisData were analyzed using SPSS 13.0 software. Results are presented using means±SD. Comparison of means between two samples was performed using Student's t test. Statistical comparisons of more than two groups were performed using one-way analysis of Variance (ANOVA), and then multiple comparisons were performed using least-significant difference (LSD). In all cases, P< 0.05 was considered statistically significant.3. Results3.1. De Velopment of CNE-2 cells down-regulation GnT-VAfter being screened for one month under G418 (2 mg/ml), cells containing the recombinant plasmids were harvested by fluorescence microscopy.The expression of GnT-V mRNA in CNE-2 GnT-V/2224 and CNE-2 GnT-V /1564 cells were decreased by (67.00±3.00) % and (57.33±5.03) % compared to CNE-2, respecti V ely by qRT-PCR (Fig.1B). The GnT-V protein in CNE-2 GnT-V /2224 and CNE-2 GnT-V/1564 cells compared with CNE-2 was decreased by(66.33±4.51) % and (58.33±4.73) % respecti Vely by western blot (Fig.1C). It confirmed the decreased expression of GnT-V at both the mRNA and protein level in CNE-2 GnT-V/2224 and CNE-2 GnT-V/1564 cells when compared with the control groups of CNE-2 cells and CNE-2 GnT-V/NC cells. Furthermore, the pGPU6/GFP/Neo GnT-V/2224 plasmid reduced the GnT-V expression more efficiently than pGPU6/GFP/Neo GnT-V/1564 plasmid, so CNE-2 GnT-V/2224 cells were chosen for further assays.3.2. Down-regulation of GnT-V inhibits cell proliferationGrowth rates of CNE-2 GnT-V/2224 were lower than those of CNE-2 GnT-V /NC and CNE-2 over a 5-day period, suggesting that suppression of GnT-V may inhibit the proliferation of the CNE-2.3.3. Down-regulation of GnT-V inhibits cell migration.Healing rates of CNE-2 GnT-V/NC and CNE-2 were higher than that of CNE-2 GnT-V/2224 at 12 and 24 h. CNE-2 GnT-V/2224 showed decreased migration acti Vity as a result of reduced GnT-V.3.4. Down-regulation of GnT-V inhibits cell invasionMore cells penetrated the matrigel-coated membrane in CNE-2 GnT-V/NC and CNE-2 than in CNE-2 GnT-V/2224, which provided evidence that down-regulation of GnT-V may reduce cell invasion ability.3.5. Down-regulation of GnT-V inhibits cell heterogeneous adhesion abilityThe adhesion rate for CNE-2 GnT-V/2224 was lower than that for CNE-2 GnT-V /NC and CNE-2, which showed that CNE-2 GnT-V/2224 heterogeneous adhesion ability was decreased after down-regulation of GnT-V.3.6. Down-regulation of GnT-V inhibits cell adhesion to EA.hy926Numbers of CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC interaction with EA.hy926 were (57.60±12.85) and (240.80±29.50) (P<0.001,t=22.053) respectively, suggesting that knockdown of GnT-V attenuated tumor cell adhesion to EA.hy926 in a flowing environment. 3.7. Down-regulation of GnT-V enhances cell radiosensitivityAfter radiation by 2 Gy,4 Gy,6 Gy, and 8 Gy, survival fractions of CNE-2 GnT-V/NC were higher than those of CNE-2 GnT-V/2224, and similar to those of CNE-2. The SER was 1.37, which indicated knockdown of GnT-V enhances the radiosensitivity of CNE-2 cells.3.8. Down-regulation of GnT-V induces apoptosis and blocks cell cycle Gl/S phase transitionCell apoptosis rates in CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC were (35.31±2.61)% and (18.97±1.64)% by TUNEL assay (t=11.867, P<0.05). Cell apoptosis rates for CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC were (26.11±2.43) % and (10.80±1.90)%(t=8.580, P<0.05), indicating down-regulation of GnT-V induces apoptosis. G1 phase cells in CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC were (59.93±2.38)% and (43.43±2.90) % (t=13.027, P<0.05). S phase cells in CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC were (28.40±0.27)% and (41.60±1.74) %(t=7.628, P<0.05), respectively. The cell cycle progression was arrested from Gl to S phase, showing that down-regulation of GnT-V blocked Gl/S phase transition.3.9. Down-regulation of GnT-V inhibits the expression of bcl-2 protein and radiation further reduces the bcl-2 protein in CNE-2 GnT-V/2224. Suppression of GnT-Vhas no effect on E-cadherin protein.Compared with CNE-2 GnT-V/NC, bcl-2 protein expression in CNE-2 GnT-V /2224 was decreased by (53.00+3.61) % by western blot, which was confirmed in liver transplanted tumor by immunohistochemisty. Furthermore, the bcl-2 protein was further decreased by (25.33±9.07) % in CNE-2 GnT-V/2224 after radiation compared with CNE-2 GnT-V/2224 before radiation. Though densitometry value of bcl-2 normalized to GAPDH in CNE-2 GnT-V/NC before and after radiation was (80.67±2.52) % and (75.67±6.03)%, the difference between the two values had no statistical significance (t=1.326, P=0.256). The results indicated that down-regulation of GnT-V might inhibit expression of bcl-2 protein directly and radiation could result in the greater suppression of bcl-2 proteinNo significant difference of E-cadherin protein was found between CNE-2 GnT-V/NC and CNE-2 GnT-V/2224 by western blot. Suppression of GnT-V might have no effect on E-cadherin..Conclusion:1,The shRNA expression vectors aimed at GnT-V gene can down-regulate the expression of GnT-V both in the level of mRNA and protein obviously.2,Down-regulation of GnT-V expression can significantly inhibit proliferation, migration, invasion, Gl to S transition and enhance cell apoptosis.3,Down-regulation of GnT-V enhanced the radio sensitivity, which may be related to bcl-2.4,Down-regulation of GnT-V had no effect on E-cadherin. |
PDF Full Text Request