| Lpin1 gene may encode Mg2+-dependent phophatidate (PA) phosphatase. It had an important influence for the deposition of animal fat, when Lpin1 gene was not expression, expression in normal, or overexpression will lead to dramatic changes in fat deposition; in addition, the deletion, reverse and duplication of sequence of Lpin1 gene may lead to more serious diseases. The conclusion from transgenic mice with overexpression Lpin1 and natural populations were opposite, there were few studies about Lpin1 gene in chicken. Thus we carried out the studies about identification of alternative splicing of Lpin1 gene, expression patterns of Lpin1 variations, the mution in flanking region of Lpin1 gene and it's correlation with properties in Gushi resources group.We made a long-range PCR amplification using primers which crossing the coding region, then we identified three transcript variants, which were named Lpin1-α, Lpin1-βand Lpin1-γ. Based on the derived Lpin1 gene sequences of different variants we designed their specific primers, respectively, semi-quantitative PCR and Taqman real-time quantitative PCR were used to detection the expression patterens of total Lpin1 gene, Lpin1-αgene and Lpin1-βgene. The results showed that total Lpin1 gene, Lpin1-αgene and Lpin1-βgene were expressed in all tissues, total Lpin1 gene had a highest expression in ovary, lowest expression in pancreas; Lpin1-αgene had a highest expression in ovary, lowest expression in pancreas; Lpin1-βgene had a highest expression in crureus and pectoralis, lowest expression in pancreas.We detected the expression patterns of Lpin1 mRNA variants in different tissues in two kind of chickens (black feather chicken and yellow feather chicken, the average weight of yellow feather chicken were 1kg weight than black feather chicken) through Taqman fluorescent quantitative PCR, the results showed that total Lpin1 gene and Lpin1-αhad the highest expression in ovary, the lowest expression in pancreas; Lpin1-βhad the highest expression in crureus and pectoralis, the lowest expression in pancreas in black feather chicken and yellow feather chicken. We deteced the expression characteristics of Lpin1 mRNA variants in different growth period in silky through Taqman fluorescent quantitave PCR, the results showed that, in liver, Lpin1 mRNA variants had the highest expression in 1 day, reached to significant difference with the expressions in the other weeks; in skin, Lpin1 mRNA variants had the highest expression in 1 day, but didn't reach to significant differences with the expressions in the other weeks; in muscle, Lpin1 mRNA variants had the highest expression in 8 weeks, and reached to significant difference with the expression in 4 weeks and 16 weeks.Quantitative PCR analysis showed that expression of chicken the expression of total Lpin1 gene ,Lpin1-αand Lpin1-βwere increased by energy restriction, total Lpin1 gene was increased 3.8-fold in energy restriction group birds compared with free feeding group birds in liver tissue, Lpin1-αgene was 4.4-fold in energy restriction group birds compared with free feeding group birds in liver tissue, Lpin1-βwas increased 4.0-fold in erengy restriction group birds compared with free feeding group birds in liver tissue.We select DNA from blood of silky, leghorn, lushi, rock, gushi, henan game and gushi-anka F2 resource population chicken as study subjects, there were six SNPs and a MNLP in 3′untranslated region of Lpin1 gene by sequencing through direct and clone methed; there were eleven variants in 5′untranslated region of Lpin1 gene, include eight SNPs, a QNP, a MNLP and a insert/delete. Genetyping the C/G mutation in 3′UTR and the MNLP(CAAGAGAATAACCCTTGCTGGA/TCTATTTCATT)variantion in 5′UTR, respectively, then made correlation analysis with properties of resource polulation. The results showed that, the effect of C/G mutation in 3′UTR of Lpin1 gene reached to significant difference with pectoralis fiber diameter. The effect of CAAGAGAATAACCCTTGCTGGA/TCTATTTCATT variation in 5′UTR of Lpin1 gene reached to significant difference with crureus fiber diameter, pectoralis fiber diameter and the glucose levels in blood.The predict of miRNA banding sites in 3′UTR of Lpin1 gene revealed the C/G mutation lead to alter of miRNA banding sites through Microspector. We selected five subjects from gushi-anka F2 resource population with different genetype based on C/G mutation in 3′UTR of Lpin1 gene, the results from expression characteristic analysis of different genetype showed that, the expression of Lpin1 transcript variants were no significant different among genetype, the expression of Lpin1-βwas significant difference between muscle and liver in different genetype.We studied the expression characteristic of Lpin1 mRNA transcript variants and analyzed polymorphism of flanking region of Lpin1 gene in chicken, this lay the foundation for study the role and interpreting the molecule mechanism of adipose deposition of the chicken Lpin1 gene. |