Construction And Expression Of Gene Encoding Non-structural Protein 4A Derived From Japanese Encephalitis Virus

The recombinant plasmid pJNS4A was constructed by RT-PCR method. The plasmid was transfected into China hamster ovary(CHO) by Lipofectamine 2000. The coding protein expression and distribution was detected by immunoflurescence. This study will lay the foundation for the interaction between no-structural proteins of Japanese encephalitis virus(JEV), and virus virulence.Materials and Methods1. Materials(1) Cells, plasmids and strainsChinese hamster ovary cells were purchased from shanghai cell bank of chinese academy of science and grown at 37℃in Dulbecco'modified eagle medium(D-MEM) supplemented with 10% fatal calf serum(FCS) and 5%CO2.BALB/c mice were purchased from shanghai animal center of chinese academy of science.The recombinant with gene encoding pJNS4A was constructed by us before and named pJNS4A, eukaryotic expression vector pcDNA3.1(+) was purchased from Invitrogen company, which was used for construction of fusion gene encoding JEV NS4A protein.Escherichia coli JM109 and DH5a were purchased from Takara company and were used for construction and transformation of recombinant plasmid.(2) Main reagents and antibodyRNAiso Reagent(Takara, Code No.D312), High Fidelity PrimeScriptTM RT-PCR Kit(Takara, Code No.DR027A), DNA Fragment Purification Kit Ver.2.0(Takara, Code No.DV807), DNA A-Tailing Kit(Takara, Code No.D404), Agarose Gel DNA Purification Kit Ver.2.0(Takara, Code No.DV805), DNA Ligation Kit＜Mighty Mix>(Takara, Code No.D6023), Plasmid Minidose Abstraction Kit(Takara, product No. DV801 A), restriction endonuclease EcoRI,BamHI and NotI were all purchased from Takara company, which were used construction and identification of recombinant plasmid. Lipofectamine 2000 was purchased from Invitrogen company and was used for transfection into CHO cells. Ampicillin was puchased from Sigma company, Agarose was purchased from Takara company, they were all used for transformation and electrophoretic analysis of plasmid. Dulbecco'modified eagle medium,10% fatal calf serum, penicillin and streptomycin were all purchased from Hyclone company and used for cultivation of CHO cells. DYKDDDDK Tag Antibody(Binds to same epitope as Sigma's Anti-FLAG M2 Antibody) was purchased from Santa company, Fluorescein-Conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) was purchased from beijing Zhongshan company, they were all used for immunofluorescence.2. Methods(1) The recombinant construct of JEV NS4A protein encoding geneTotal RNA of SA14-14-2 strain in Japanese encephalitis virus is as templates, using RT-PCR to amplify JEV non-structura protein 4A genes and addin initiation codon and termination codon to the Bilateral genes; Bilateral genes are admoved BamHI/EcoRI Enzyme Cutting site Reverse transcription primer:5'GAATTCTTA GGCTCCTGCACAAGCTATGAC 3', restriction incision enzyme EcoRI(-GAA TTC-) is synthetic in 5'terminatio PCR amplification prorsad primer:5'GGATCCATGA CTAAAAAACCAGGAGGGC 3',BamHI(-GGA TCC-) is synthetic in 5'terminatio, reverse primer is primer above-mentioned.Electrophoresis using 1% Agarose Gel and retrieve PCR product, latter and pMD19-T simple bond to build recon pMD-JNS4A.Use PrimeSTAR(?) HS DNA Polymerase(Code No.DR010S)to undertake PCR amplification of pMD-JNS4A in according to CTB 906F(5'CGGGATCCAT GGACTACAAGGACGACGATGACAAGATGTCAGCCGTTAGCTTCATAG3')as templates. PCR amplifi-cation product is named Insert DNA after carried out to cutting glue and retrieved about 900bp fragment using TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No. DV805A) with used BamH I/EcoRI to realized enzyme incise and undertaked ethanol precipitation. Plasmid pcDNA3.1(+) is named Vector DNA. after Using BamH I/EcoR I to proceed enzyme incise and using TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No.DV805A) to cut glue and retrieve about 5.4kbp DNA fragments; Insert DNA and Vector DNA then are spread plate and stay overnight cultivation in 37℃after using Solution I in TaKaRa DNA Ligation Kit (Code No. D6022) to couple with them followed thermo-conversion to E.coli Competent Cell JM109 (Code No. D9052), then choosing male bacterial colony to plant and extraction for plasmid named pJNS4A. Using primer BGHrev to proceed sequencing of above-mentioned plasmid, result is well. Transform pJNS4A to escherichia coli DH5a and extract low dose plasmid followed identification by BamH I/EcoR I enzyme incise and Electrophoresis.(2) PJNS4A transiently transfected into CHO cellsTransfection:Before the experiment in 6-well plates in cultured CHO cells, the concentration of cell growth to be about 90%-95% per 500ul containing 0.5-2.0×105/ month.The preparation of liposome/plasmid mixture:solution A:The recombinant plasmid pJNS4A and empty vector pcDNA3.1 (+) of 8μg (per hole) by adding DMEM culture medium 500ul, the solution for the total volume of 250μl (per hole) and gently mixeduniform; Solution B:liposome by adding 500μl DMEM will 20μl culture medium, a total of four, gently mixing at room temperature, incubated 5min; will be diluted recombinant plasmid pJNS4A,250μl diluted liposome mixing gently, incubated for 20min at room temperature(where the solution becomes turbid) to form a liposome/ plasmid mixture; with serum-free antibiotic-free D-MEM culture medium wash cells three times within a short time before the replacement of transfected Iml37℃temperature and a good pre-serum-freeantibiotics, D-MEM culture medium; to 6 well plate by adding 500μl drop of liposome/plasmid mixture, while increases while shaking culture plate; in 37℃,5% of the CO2 in the culture for 4 hours in serum-free antibiotic-freeDMEM culture medium.Filter:6-well plates were incubated for 24 hours to 24-well plates, containing the concentration of G418 was followed by 50,100,200,300,400,500,600,700,800,900 mg/ L of DMEM culture.The concentration of each set three holes, and the remaining three holes for normal cell control.Determined after 15 d culture can kill all cells in the lowest concentration of G418 as the best screening test concentration, that is, the maintenance of 100 m L train.(3) Immunofluorescence assay Trypsin digestion and transfected CHO cells and normal cells seeded in 6-well its the coverslip to the slide covered with no overflow of degrees at 37℃,5% CO2 under the conditions of normal culture when cell density reached About 60% of a 70%,4% paraformaldehyde fixed cells,1 h,0.1% Triton X.100 Punch 10 min,10% BSA closed 1 h, rabbit anti-mouse IgG Fc diluted 1:800 respectively,4℃overnight incubation.FITC-Goat anti-rabbit IgG diluted 1:00 according to the concentration of dark at 37℃incubation 1 h,50% glycerol Fengpian observed under fluorescent microscope after fluorescent labeling.Results1. JEV non-structural protein NS4A coding genes and identification of recombinant plasmid(1) As Japanese encephalitis virus SAM-14-2 strain Total RNA for template, we obtain the recombinant pJNS4A though RT-PCR, The outcome of sequencing analysis is in line with the gene order which have published, enzyme cutting appraisement indicatding:The molecular weight of recombinant plasmid which enzyme cutting by BamHI/EcoRI is about 900bps, which is in line with pJNS4A be enzyme cut with the same enzyme, The sequence analysis showed that purpose genes were in their corret sites.(2) pJNS4A the emotional state will be amplified in E. coli, extracted plasmid RNA, DNA electrophoresis of their identification line.Known pJNS4A size is about 843 bps, can be seen in the corresponding position on a clear strip. pJNS4A transfected CHO cells in the immunofluorescence assay2. Immunofluorescence assayJEV NS4A protein coding recombinant plasmid transfected CHO cells can be seen more significant green fluorescent marker, mainly in the membrane. Normal CHO cells, no specific green fluorescent marker, only to see the scattered non-specific green fluorescent impurities.Conclusions1. Constructed recombinant pJNS4A containing JEV NS4A protein coding genes.2. Transfection of the JEV NS4A protein coding recombinant plasmid CHO cells stably expressing JEV NS4A protein, mainly in the membrane.