Construction And Identification Of Gene Encoding Core Protein Derived From Japanese Encephalitis Virus

ObjectiveThe recombinant plasmid pJC was constructed by RT-PCR method.The plasmid was transfected into China hamster ovary(CHO) by Lipofectamine 2000.The coding protein expression and distribution was detected by immunoflurescence.This study will lay the foundation for the interaction between structural proteins of Japanese encephalitis virus(JEV),and virus virulence.Materials and MethodsMaterials1,Cells,plasmids and strainsChinese hamster ovary cells were purchased from shanghai cell bank of chinese academy of science and grown at 37℃in Dulbecco' modified eagle medium(D-MEM) supplemented with 10%fatal calf serum(FCS) and 5%CO₂ BALB/c mice were purchased from shanghai animal center of chinese academy of science.The recombinant with gene encoding pJC was constructed by us before and named pJC,eukaryotic expression vector pcDNA3.1(+) was purchased from Invitrogen company,which was used for construction of fusion gene encoding JEV C protein.Escherichia coli JM109 and DH5αwere purchased from Takara company and were used for construction and transformation of recombinant plasmid.2,Main reagents and antibodyRNAiso Reagent(Takara,Code No.D312),High Fidelity PrimeScript^TM RT-PCR Kit(Takara,Code No.DR027A),DNA Fragment Purification Kit Ver.2.0(Takara,Code No.DV807),DNA A-Tailing Kit(Takara,Code No.D404),Agarose Gel DNA Purification Kit Ver.2.0(Takara,Code No.DV805),DNA Ligation Kit＜Mighty Mix＞(Takara,Code No.D6023),Plasmid Minidose Abstraction Kit(Takara,product No. DV801A),restriction endonuclease EcoRâ… ,BamHâ… and Notâ… were all purchased from Takara company,which were used construction and identification of recombinant plasmid.Lipofectamine2000 was purchased from Invitrogen company and was used for transfection into CHO cells..Ampicillin was puchased from Sigma company,Agarose was purchased from Takara company,they were all used for transformation and electrophoretic analysis of plasmid.Dulbecco' modified eagle medium,10%fatal calf serum,penicillin and streptomycin were all purchased from Hyclone company and used for cultivation of CHO cells.DYKDDDDK Tag Antibody(Binds to same epitope as Sigma's Anti-FLAG M2 Antibody) was purchased from Santa company, Fluorescein-Conjugated AffiniPure Goat Anti-Rabbit IgG(H+L) was purchased from beijing Zhongshan company,they were all used for immunofluorescence.Methods1.The recombinant construct of JEV C protein encoding geneTotal RNA of SA14-14-2 strain in Japanese encephalitis virus is as templates,using RT-PCR to amplify JEV core protein C genes and addin initiation codon and termination codon to the Bilateral genes;Bilateral genes are admoved BamHâ… /EcoRâ… Enzyme Cutting site Reverse transcription primer:5'GAATTCTTAGGCTCCTGCAC-AAGC -TATGAC 3',restriction incision enzyme EcoRâ… (-GAA TTC-) is synthetic in 5'terminatio PCR amplification prorsad primer:5'GGATCCATGACTAAAAAACCA-GGAGGGC3', BamHâ… (-GGA TCC-) is synthetic in 5'terminatio,reverse primer is primer above-mentioned.Electrophoresis using 1%Agarose Gel and retrieve PCR product,latter and pMD19-T simple bond to build recon pMD-JC.Use PrimeSTAR(?) HS DNA Polymerase(Code No.DR010S)to undertake PCR amplification of pMD-JC in according to CTB905F(5'CGGGATCCATGGACTACAAGGACGACGATGACA-AGATGACTAAAAAACCAGGAGGG3') as templates.PCR amplification product is named Insert DNA after carried out to cutting glue and retrieved about 500bp fragment using TaKaRa Agarose Gel DNA Purification Kit Ver.2.0(Code No.DV805A) with used BamHâ… /EcoRâ… to realized enzyme incise and undertaked ethanol precipitation. Plasmid pcDNA3.1(+) is named Vector DNA.after Using BamHâ… /EcoRâ… to proceed enzyme incise and using TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No.DV805A) to cut glue and retrieve about 5.4kbp DNA fragments;Insert DNA and Vector DNA then are spread plate and stay overnight cultivation in 37℃after using Solutionâ… in TaKaRa DNA Ligation Kit(Code No.D6022) to couple with them followed thermo-conversion to E.coli Competent Cell JM109(Code No.D9052), then choosing male bacterial colony to plant and extraction for plasmid named pJC. Using primer BGHrev to proceed sequencing of above-mentioned plasmid,result is well.Transform pJC to escherichia coli DH5αand extract low dose plasmid followed identification by BamHâ… /EcoRâ… enzyme incise and Electrophoresis.2.pJC transiently transfected into CHO cellspJC was transfected into CHO cells by the liposome method,at the same time, CHO cells transfected with pcDNA3.1(+) and CHO cells untransfected were used as negative controls.1.One day before transfection,4×10⁵ CHO cells were plated in 1000μl of D-MEM without antibiotics per well so that they would be 90-95%confluent at the time of transfection.2.transfection:trypsinization the CHO cells for transfection, and having an inoculation them to the each coverslip of 6 shadow mask..make sure the CHO cells not overflow,rasing the CHO cells at 37℃in a CO₂ incubator until they would be 90-95%confluent at the time of transfection;prepare the mixture of liposome/plasmid:solutionA:put pJC into D-MEM culture solution as each hole 4ug, also the pcDNA3.1(+),make sure the bulk volume 250ul for each hole,misce bene lightly;solutionB:put liposome(10ul) into D-MEM culture solution(240ul) with two tubes;misce bene lightly;incubation 5min at room temperature;put pJC (diluted)/pcDNA3.1(+)(diluted) into the dilution of liposome(250ul),misce bene lightly; incubation 20min at room temperature(in this time,the solution can be muddy) in order to form mixture of liposome/plasmid;wash the cells with D-MEM culture solution(no FCS and no antibiotic)3 times,replace the D-MEM culture solution(no FCS and no antibiotic) with 1ml,dropwise the mixture of liposome/plasmid(500ul) to ench hole,in the same time,shaking the 6 shadow mask;after incubation 5～6h at 37℃in a CO₂ incubator wash the cells with D-MEM culture solution(no FCS and no antibiotic) 3 times,replace the D-MEM culture solution(no FCS and no antibiotic) with D-MEM culture solution inclouding FCS,conventional culture 72h;after trypsinization the cells, inoculating them to the new D-MEM culture solution,conventional culture 72h for the nest immunofluorescence.3.Immunofluorescence assayCHO cells were plated in a 6-well format,when they were 60-70%confluent,4% paraformaldehyde had been added into each well containing CHO cells for 1hour, 0.1%Triton-100 for 10min,10%BSA for 1hour,then they had been incubated with DYKDDDDK Tag Antibody(Binds to same epitope as Sigma's Anti-FLAG M2 Antibody) for 18 hours and with Fluorescein-Conjugated AffiniPure Goat Anti-Rabbit IgG(H+L) for 1 hour at 37℃without light.Results1,Construction and identification of the recombinant pJCAs Japanese encephalitis virus SA14-14-2 strain Total RNA for template,we obtain the recombinant pJC though RT-PCR,The outcome of sequencing analysis is in line with the gene order which have published,enzyme cutting appraisement indicatding:The molecular weight of recombinant plasmid which enzyme cutting by BamHâ… /EcoRâ… is about 500bps,which is in line with pJC be enzyme cut with the same enzyme,The sequence analysis showed that purpose genes were in their corret sites.2,PJC transfected CHO cells in the immunofluorescence assayThe green fluorescence mark was mainly distributed obviously in endochylema of transfected CHO cells with pJC,and not much in membrane.It didn't apperance in untransfected CHO cells and transfected CHO cells with pcDNA3.1(+).Sometimes, some unspecificial fluorescence substance apperanced in them.Conclusions1,The recombinant named pJC contained genes of pJC.2,Transfected CHO cells of the pJC can express JEV C protein,mainly in the cytoplasm,a small amount distributed in the membrane.