Association Of Estrogen Receptor Gene Polymorphism And Intrahepatic Cholestasis Of Pregnancy

1. ObjectiveThe purpose of the present study was to investigate into the relationship between polymorphisms of the estrogen receptor gene alpha ( ER α ) and patient with intrahepatic cholestasis of pregnancy of JiangXi Han nationality crowd .2. Method2.1 Process of objectThe study involved 54 affected and 54 healthy control pregnant women. These case all came from JiangXi Women and Children Hospital and Health Institute during August, 2004 to March, 2005. They are all Han nationality of JiangXi province.2.2 Experimental methoda.) Template DNA is made by hydroxybenzene/chloroform method from venous anti-thrombin DNA.b.) Use PCR to amplify the target DNA fragment. Amplified inducer sequerce is :F(5' to 3'): CCTCTGATTTTCACGCAGTC R(5' to 3'): ACCTGCACCAGAATATGTTACC...