The study of exocrine pancreas is to observe pancreas normocrinic process ,or diagnose pancreas disease ,or observe the effect and influence of some medicine to pancreas by way of the physiology or pathology.The purpose of this experiment is to found an animal modPEL which could be observed exocrine pancreas directly in vivo, and the externalization of trypsinogen II dynamically. In order to found an animal modPEL for studying the physiological functions of exocrine pancreas and the pathology physiological functions of disease corrPELated with exocrine pancreas ,such as pancreatitis and pancreatic cancer, screening medicine to cure disease above-mentioned, our study is as follows:1. The construction of target gene:(1) The synthesis of signal peptide (Pre-pro) gene of trypsinogen Ⅱ with 5' -EcoR I and 3'-BamH I: 5' aattcatgagtgcacttctgatcctagctcttgttggagctgctgttgctttccccgtggatgatgatgacaaga3' gtactcacgtgaagactaggatcgagaacaacctcgacgacaacgattggggcacctacgactactgttct tcgttggag 3' agcaacctcctag 5' (2)The construction of pPreEGFP: After digestion with restriction endonuclease,Pre-pro gene was cloned into EcoR I and BamH I sites of pEGFP-Nl to connect 5'EGFP with Pre-pro gene.(3)The construction of pPEL-PreEGFP: pPEL,the specificity promotor,whichexpressed specificity in pancreas was cloned into Hind IH and EcoR I sites ofpPreEGFP to 3' pPEL(4)The construction of targete gene PEL-Pre—EGFP:After digestion with two typesof restriction endonuclease from 622bp to 2926bp,BindIII and Sph I ,the plasmid ofpPEL-PreEGFP obtained target gene with 2305bp.2. The construction of PEL-Pre-EGFP transgenic mouserthe target genes were microinjected into the male pronuclei of the mouse fertilized eggs,then these zygotes were transplanted into the oviducts of pseudo- pregnant recipient female mouse,which would produce FO-generation transgenic mouse.3. The detection of PEL-Pre—EGFP transgenic mouse(l)Green flourescence was expressed in pancreas of the FO generation transgenicmouse or not by holo-formatter(2)PCR were used to screen whether there were PEL-Pre-EGFP in FO-generationtransgenic mouses.(3)Sothern Blot were used to affirm whether there were PEL-Pre—EGFP in FOgeneration transgenic mouses.In our experiment,the target gene,PEL-Pre-EGFP,was constructed successfully.Nearly 40% zygotes (520 zygotes in 1288) were survived after microinjection. Then these zygotes were transplanted into the oviducts of pseudo-pregnant recipient female mouse. About 4.6% fetus could develop normally. 24 FO generation transgenic mouses were born, Seven of them were positive by PCR analysis,and by Southern Blotting one was positive for target gene integration.The positive rate was 4% . There was no green flourescence was obversed in pancreas by holo-formatter among the FO generation transgenic mouses . Though we did not observe externalization of trypsinogen II in pancreas until now.but we have construct the target gene successfully. And have detect the integration of the target gene. In the experiment ,the author have master the processof establishment the transgenic animal,Including the constructong and evaluation of upper stream plasmid,the procedur of microinjection, such as making the microinject-tube,holding zygote- tube,washing zygote-tube and shifting zygote-tube,the deligation of male mouse,the superovulation of mice, making the pseudocyesis, the collection .cultivation, microinjection and transplantation of the zygote.the experiment work offers a feasible way of animal modle of abserving the exocrine pancreas,and have studied primerly the possibility of establishment the transgenic animal model having having visual exocrine pancreas.And the KM mice we used in the experiment have clear genetic background and can inherit stably, so we can use it as the basis of eastablish the transgenic animal having visual exocrine pancreas. In conclusion, the experiment have sense to study of the establishment of the transgenic animal having visual exocrine pancreas.
|