| This study select koraiensis 25 populations for a total of 125 research subjects from the north-east of China-Jilin, Liaoning, Heilongjiang, research fragment of mtDNA pinus koraiensis coxIII genetic diversity and phylogent evolution.Study select coxIII's primer fragments are 5'CAGTACCATGCAGCTGCTTC3', 5'GGTAGATCCAAGTCCATGGC3'. Through extraction of template DNA,template DNA purification, PCR amplification, PCR product identification, PCR product sequencing, sequence analysis, the results of the experiment have been concluded as follows:1. Analysis of pinus koraiensis mtDNA variation. We study the nucleotide variation of mtDNA genetic diversity of pinus koraiensis from the nucleotide composition, coxIII fragment length, mtDNA variation. Through analysis of nucleotide composition ,the ranges of the four nucleotides and the average are that A 21.7% (21.4% -22.2%); T 30.9% (30.5% -31.7%); G 22.4% (22.2% -22.6%); C 25.1% (24.7% -25.2%).there are some variations, but the degree of variation was not obvious, and less individual Mutated. Range of coxIII Fragment`s length is 628bp-631bp, four kinds of length sequences, the degree of fragment length variation is very little. After the Clustal analysis we get 30 Variable sites, the times of the total variation are 68 ,the rate of Variable sites is 4.7%, the singleton variable sites are 23, parsimony informative sites 7, the degree of pinus koraiensis mtDNA mutate is higher.2. determine the haplotypes of Koraiensis populations. In this study, samples of the populations selected are found 36 kinds of haplotypes named H1-H36, in which there is one kind haplotype (H1) for the mainstream haplotype in all populations exist. 35 haplotypes exist in 19 populations, this article detailed describe the Relations 19 populations and 35 haplotypes.3. Construction of phylogenetic trees. In this study, using the MEGA 4.0 software Neighbor-Joining and minimum evolution method, in the target of pinus koraiensis populations haplotypes, phylogenetic trees were constructed. By constructing phylogenetic trees we found the evolution relationship of pinus koraiensis populations, H13, H14, H15, H21, H22, H24, H26, H27, H29, H31, H32, H33 have closer relationship, H23,H10 are closer with them; and H16, H11, H3 clustering together prove that they have closer genetic relationship; H4, H5, H6, H7, H8, H17, H30 such as clustering together to prove that they have closer genetic relationship. mtDNA have paternal genetic effect,there is Pollen flow between closer relationship populations.the possible reasons are the mountain barrier and climate.Among the Study home and abroad, there are few research about the pinus koraiensis populations Relationship and at the most time researcher think that mtDNA sequence is too Conservative to the study of plant relationships. For the male Genetic of the pinus koraiensis, mtDNA sequence has a special significance to the study. this study not only provide scientific future research not only provides scientific reference for future research, but also provide the theoretical basis for the pinus koraiensis hybrid and pinus koraiensis breeding. |
