Potato (Solanum tuberosum L.), a crop which can be consumed as both vegetable and grain, plays an important role in people's life. However, it suffers severe yield and quality losses these years because of plant diseases, among which diseases caused by bacteria were important ones. Potato blackleg, a seed tuber-borne disease, was caused by Erwinia carotovora subsp. atroseptica (Eca) in temperate regions. This disease dramatically affects potato production and quality. In this research, ten diseased samples were collected from Inner Mongolia, Heilongjiang, Gansu, Guangdong, and Guangxi where potato is an important crop. Based on these samples, separation, purification and preservation of the Eca were made, and its pathogenicity was tested. The primer was designed for PCR, and Eca was amplified and sequenced. According to the sequence, the primer for real-time quantitative PCR was also designed, and test was then made for the detection of Eca using this technique. Finally, various techniques were compared for their sensitivity of test for potato blackleg. The main results are as follows:(1) Ten strains of E. carotovora subsp. atroseptica were got on crystal violet pectate (CVP) medium. The CVP medium was then optimized. Three typical strains were tested for their pathogenicity on potato.(2) Based on downloaded sequence information, the primer Eca1g (5′GAAACCGTCA CGCTGGATAAC3′) Eca2g (3′AAGGTGTTGGGCAGATTGAGT5′) was designed. After extraction of DNA from the ten bacteria, PCR of 16S rDNA experiments were done with the bacterial specific primer and a DNA fragment of 681 bp was got from the potato blackleg strain. In this PCR reaction system, annealing temperature should be set at 56.4℃and Mg2+ concentration be 2.5 mM. The primer was found to have higher specificity, and the nucleotide sequence of the amplified fragment was tested.(3) The primer Yg1 (5′GAATATCAATAGCACTATCCTCAG3′) Yg2 (5′CACATTATCAAC CAACAGAACC 3′) was designed base on sequence determined, with which a 181-bp PCR product was obtained from the potato blackleg strain. The real-time quantitative PCR result showed that the amplification curve of the potato blackleg strain was smooth and the main peak was obvious. The amplification curves of every two replicates were almost superposable and the CT values were nearly equal.(4) Ten-fold serial dilutions of target cell solution(ranging from 3.6 ~ 3.9×107 cfu/mL to 3.6 ~ 3.9×10-1 cfu/mL)were prepared and ddH2O was used as negative control for comparisons of three test methods. The testing capability was 3.1×102 cfu/mL for CVP medium, 36 ~ 39 cfu/mL for traditional PCR, and 3.6 ~ 3.9 cfu/mL for real-time quantitative PCR.The real-time quantitative PCR method established by this research could be used to detect Erwinia carotovora subsp. atroseptica from sick plants for quarantine department and the seed industry. And it would become a foundation for future research... |