Cloning And Sequence Analysis Of Goose TSH-β Gene And Its Polymorphism Association With The Laying Performence

Reproduction of many temperate birds is under photoperiodic control. TSH triggers photoperiodic response, whose beta submit determines its function. Therefore, this experiment was conducted to clone and analyze sequence of goose TSH-βgene first time, it is very meaningful for further investigating molecular mechanism of how effect of TSH on goose reproduction performance. And for proveding the useful materials to molecular marker-assisted selection to laying trait of goose, we find the of its polymorphism association with laying performance of yangzhou goose. The results are as follows:1.The sequences of 5'FR, exon1, intron1, exon2, intron2, exon3 and 3'FR of goose TSH-βgene were amplified from goose genomic DNA by PCR. The PCR products were subcloned and the sequences were confirmed by sequence analysis, whose length were 200bp, 65bp, 876bp, 163bp, 782bp, 324bp and10bp, respectively. In addition, prediction of the 5' flanking region of the goose TSH-βgene by TFSEARCH and Neural Network Promoter Prediction reveals several regulatory sequences, such as two TATA fragments in the promoter region, two Pit-1 responsive elements, AP-1 responsive element, and GATA-3 responsive element. The GenBank accession number of nucleotide sequence of goose TSH-βgene is EU925400, EU939683, FJ393275 and FJ797681, respectively.2. Homologue analyzed reveals that the sequence of TSH-βgene exon1 of goose is similar to that of duck and ibis, and the homologies are 100%, 95%, respectively. The homologies of goose TSH-βexon2 with those of duck, ibis, chicken, quail and Zebra Finch are 98%, 96%, 95%, 92% and 92% respectively, and similarities of goose TSH-βexon3 with them are 99%, 97%, 96%, 96% and 94%, respectively. Similarities of goose TSH-βintron1 with those of ibis and chicken are 85%, 77%, respectively, and similarities of TSH-βintron2 of goose with those of ibis, chicken and Zebra Finch are 75%,74% and 60%, respectively .The homologies of the amino acid sequence of goose TSH-βcompared with those of duck, ibis, chicken, quail and Zebra Finch are 99%, 97%, 96%, 96% and 94%, respectively.3. According to sequence of goose TSH-βgene, four pairs of primer were designed to screen the population of 46 yangzhou geese by PCR-SSCP, hoping to find the association of polymorphism of goose TSH-βgene and the laying performance.The results showed that: (1)The polymorphism was detected with primer I2 by PCR-SSCP. Two types of nucleotide sequences from 205 to 212 site of intron2 of goose TSH-β, the nucleotide sequence of AACAACAGTGAATTCTGTGG or AGTTTAT, was found by sequencing. Three genotypes AA, AB, BB were found with the gene A frequence of 0.6596 and the gene B frequence of 0.3404. (2)The least square analysis showed that the average egg production of BB genotype geese was higher than that AA genotype geese(p<0.05).