| Infectious Bovine Rhinotracheitis (IBR) is an acute infectious disease with fever in bovines caused by IBRV. The samples were collected from nose secretion in fever phase of bovines and the samples were treated with the general method, then they were cultured in MDBK cell line. The virus particle were morphologically similar to Bovine herpes virus,being spherical with envelope, 150nm~194nm in diameter. The virus had a positive reaction with a neutralization test. PCR test also confirmed the isolate virus was IBRV. We also collected 217 sera from bovines in infectious periods. Among them,62 sera of the cantles showed positive with neutralization test. Positive rate was 28.6%.The sera results suggested that the bovines in Jinan city had been heavily infected by IBRV.A pair of primers designed according to the published sequence of the IBRV. The primers are P1 5'- TACGACTCGTTCGCGCTCTC -3',P2 5'- GGTACGTCTCCAAGCTGCCC -3',P35'- TCTCGACCGGGGACATTATC-3' ,P4 5'- GCCTCTTCGATCACGCAGTC-3' It has shown that the PCR systemic has premium conditions,that is the denaturing temperature is 94℃,the anneal temperature is 56℃,the circles are 30 times ,respectively. The outer primer amplify 478bp specific IBRV fragment and the inner primer can amplify 385bp fragments, which accords with the predicted amplification segament. Howerver it had no positive result with the system to amplify Bovine viral diarrhea virus, Bovine Rotavirus, Bovine coronavirus. So it can... |