| Hepatitis B virus infection is one of the most widespread viral infections of human, it is responsible for significant morbidity and mortality, despite the availability of safe and efficacious injectable vaccines. Continued transmission of HBV is thus assured by the existence of this large reservoir of persistent human carriers. It was estimated that some more 3000,000 new cases occurred annually despite the availability of a hepatitis B vaccine. The worldwide problem of HBV infection and its association with chronic liver disease has necessitated the development of an effective Vaccine. Intramuscular injections of serum-derived HBsAg or yeast-derived recombinant HBsAg (rHBsAg) in healthy individuals result in effective immunization and protection from viral infection. But in many areas of the developing world the expense of immunization programs prohibits the use of the currently available vaccines for large segments of the population. Recent studies have shown that plants can be effective tools for antigen production and delivery. There are several potential advantages of using plant technology for the production of vaccines; most notably, the overall costs can be greatly reduced compared with competing systems. This is partly due to the relatively low facility and maintenance costs required for large-scale plant production.The expression of antigens in transgenic plants has been increasingly used as an alternative to the classical methodologies for antigen expression in the development of experimental vaccines. However, an important limitation in most cases is the low concentration of the recombinant antigens in the plant tissues, which reduces the possibilities of practical applications. Thus, increasing in the concentration of the foreign protein in the transgenic plants becomes a critical issue to be considered. Recent studies have shown that tissue-specific promoters can be used as alternatives for improving the concentration of the foreign protein in the transgenic plants.In this study, we have amplified the tomato fruit specific promoter of gene 2A11 using PCR technique, and constructed a plant effective expression vectors driving by a fruit specific promoter for the expression of HBsAg, to further improve the expression of exogenous gene in plant, and to prepare for the development of effective anti-hepatitis vaccine.The promoter of tomato fruit-specific 2A11 gene in tomato was amplified by nested-primers PCR technology. DNA sequence analysis and homology comparison indicated that the result was to be proved to absent the segment of"tatattgttaacttcttgttgaattaaagcaat"from 621bp upstream transcription start site of 2A11 promoter gene and to share 61% homology with 2A11 promoter (GenBank ID M87659,1993). DNA sequence had been submitted to GenBank, and its GenBank submission number was DQ453963. Binary vector was constructed through fusing 1.3kb 2A11 promoter gene with the GUS gene. Transient GUS expressions were observed in tomato fruits transferred by Agrobacterium tumefaciens EHA105 or AGL-1. The result of GUS transient expression in tomato fruit indicated that 2A11 promoter had the function of driving the GUS gene fruit-specific expression in tomato fruit.The 2A11 gene was removed from 2A11-pMD18-T vector by Salâ… and Xhoâ… digestion and inserted into pBPF?7 (containing CaMV35S promoter, nos terminal and ? enhancer) between the constitutively-expressed cauliflower mosaic virus (CaMV) 35S promoter and Nos terminator at the Xhoâ… site to form pBHBs, then a 0.8kb DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was obtained by EcoRâ… å’ŒBamHâ… digestion and inserted into pB2A11 at the EcoRâ… /BamHâ… site to form pB2A11-HBs. The fragment containing"2A11+?+HBs+Tnos"was isolated by gel extraction from plasmid pB2A11-HBs after Pstâ… / Kpnâ… restrictive digestion and then subcloned into plasmid pCAMBIA1301 (containing hygromycin-resistant gene, kanamycin-resistant gene, GUSgene) that had been digested by the same restriction endonuclease to yield the reconstructed plant binary expression plasmid p2A111301-HBs; and the fragment containing"P35S+2A11+?+HBs+Tnos"was isolated by gel extraction from plasmid pB2A11-HBs after Pstâ… restrictive digestion and then subcloned into plasmid pCAMBIA1301 that had been digested by the same restriction endonuclease to yield the reconstructed plant binary expression plasmid pCAM2A11-HBs.Tomato high frenquencies system of regeneration was optimized from different choice of medium (T1, T2, T3, T4, T5) and explants (cotyledons, hypocotyls). Sensitiveness to Agrobacterium tumefaciens and the rate of caespitosa shoots production were studied among the cotyledons, hypocotyls and leaves of breed"MICRO-TOM". The results showed that the optimal regeneration medium was T2, cotyledon was the best acceptor material and the shoots coming from cotyledon have the best quality.On the base of the efficient regeneration system, factors that affected transformation such as the Agrobacterium concentration, infiltration time and transform style. Genetic transformation conditions were examined by GUS expression. Results showed that best transformation system could be set up by the condition of 2 days pre-culture, 5 minute infiltation of Agrobacterium solution OD600 0.1, and co-cultured with AGL-1 for 2 days in darkness. Then, selected by 20mg/L hygromycin. Appended 100umol/L AS in the co-cultivating media, Compared with the routine method, the GUS transient expression activity was highly enhanced. After the procedure of killing Agrobacterium tumefaciens, the explants should be resumed for about 1 week, and then transferred to culture medium containing antibiotic. Resuming culture will do well to efficiency of transformation.Mediated by AGL-1, the mini Ti plasmids containing HBsAg was transferred to"Micro-tom"tomato. After 3-4months, many hyg-resistent plantlets were acquired. By far, we have got the stains of"Micro-tom"tomato containing pCAM2A11-HBs, and the hyg-resistent shoots containging p2A111301-HBs and p1301HBs. The presence and integration of target gene in transgenic"Micro-tom"tomato was confirmed by hygromycin resistance, histochemical detection of GUS activity, polymerase chain reaction (PCR), Southern dot bloting and PCR- Southern analysis.The immunological activity of recombinant HBsAg in leaf was shown by ELISA. The expression of rHBsAg is better. The amount of HBsAg in transgenic tomato leaf is about 385-891ng/g fresh weight, and 0.0032-0.007 percent of total soluble protein. Up to now, we have obtained about 35 HBsAg-transgenic plants; the immunological activity of recombinant HBsAg and the expression of levels in fruits need to further detecting. Cherrytomato is a kind of novel fruit vegetable. It has high nutritious value and can be consumed raw. And the transformation system of tomato is easy. Micro-tom, super-dwarf tomato, compact, short life cycle: 70-90 days from sowing to harvest. Four generations per year. Thus"Micro-tom"tomato is one of the ideal species for expressing subunit vaccine components. In this study, we have amplified the tomato fruit specific promoter of gene 2A11 using PCR technique, and constructed a plant effective expression vectors driving by a fruit specific promoter for the expression of HBsAg, and obtained the transgenic tomato plant expressing HBsAg. We hope getting some tomato plants with high expression level and accumulation in tomato fruit tissues of the recombinant vaccine proteins, to provide some theoretic and experimental directions for research in oral vaccine of transgenic tomato.
|
PDF Full Text Request