| Background:Lung cancer accouts for the most frequent cause of cancer-related death,the overall 5-year survival rate is only 10-15%.Non-small cell lung cancer(NSCLC)accounts for approximately 80%-85%of lung cancer.Most patients are diagnosed at advanced stage due to asymptomatic in early stage.Although the treatments such as surgery,chemotherapy,radiatherapy and others have made great progress in the modern time,the outcomes of lung cancer treatment are still unsatisfactory,only 15.9%of patients can live 5 years or more after diagnosis.The low-dose CT screening results in a reduction in mortality from lung cancer.However,the limitation of screening is overdiagnosis and overtreatment.Once there are biomarkers that can predict the prognosis of lung cancer as the 21-gene panel which could predict recurrence of tamoxifen-treated,node-negative breast cancer,the screening can become more valuable.Lung cancer is a systemic disease.Adjuvant chemotherapy after completely resection of lung cancer may prevent postoperative micrometastasis,thereby may prolong the survival of lung cancer patients.Lung Adjuvant Cisplatin Evaluation(LACE)was to identify the efficacy of adjuvant chemotherapy,which collected and pooled individual patient data from five largest trials.There was a statistically significant benefit on OS for adjuvant chemotherapy compared with no adjuvant chemotherapy corresponding to an 11%reduction in the risk of death and absolute benefits of 3.9%and 5.4%at 3 and 5 years,respectively.HR for stage II patients was 0.83(95%CI,0.73 to 0.95).HR for stage ? patients was 0.83(95%CI,0.72 to 0.94).Cancer and Leukemia Group B(CALGB)9633 enrolled 344 NSCLC cases with stage IB.All cases were randomized to receive adjuvant chemotherapy or observation.The researchers reported that patients with stage IB could benefit from adjuvant chemotherapy in 2004.However,the researchers reported that the survival advantage was not observed with longer follow-up of median 74 months in 2008.International adjuvant lung cancer trial(IALT)enrolled 1,867 stage ? to ? cases.which was included in LACE,to assess the efficacy of adjuvant chemotherapy.It showed that adjuvant chemotherapy improves survival among patients with completely resected non-small-cell lung cancer based on 5-year or shorter-term follow-up data.However,the survival benefit disappeared based on a median follow-up of 7.5 years.ICAN study(NCT01106781)was designed to investigate EGFR gene mutation status,clinical outcomes and recurrent risk factors in early stage Chinese NSCLC patients with adenocarcinoma(ADC)histology after complete resection.It enrolled 568 cases and showed that Chinese patients couldn't benefit from adjuvant chemotherapy.We wondered whether Chinese lung cancer patients could benefit from adjuvant chemotherapy as caucasian cohort.The most common sites of NSCLC metastases include the brain.bone.liver.adrenal glands,contralateral lung and distant lymph nodes.Metastases to other organs are relatively rare.We defined all organs except the common metastatic sites mentioned above as uncommon sites of metastasis.There have been numerous case reports and a few small case series of uncommon metastases derived from NSCLC.Unfortunately,these reports have only marginally improved our understanding of the clinical features and outcomes of patients with the disease.Part 1 The molecular mechanism of stage I lung cancer patients with different prognosisAims:To explore the biomarkers which could predict the prognosis of lung cancer.Materials and methods:All the patients who received complete resection of primary lung cancer between 2005 to 2012 were screened.Eighteen cases with stage ? lung adenocarcinoma were included in the study finally.The indolent group contained 11 patients whose tumor grew very slowly in nearly 2-year-follow-up and the aggressive group contained 7 patients whose overall survival(OS)less than 2 years.For all tumor tissues subject to sequencing,standard frozen sectioning,hematoxylin and eosin(H&E)staining,and histological review were performed.Tumor DNA was derived from serial,twenty micron tissue sections immediately adjacent to the reference H&E section.For each case,specimens were selected that contained at least 70%tumor cells.DNA was extracted from the tumor and their matched normal lung tissue from the patients enrolled in our study.The paired-end multiplex exome sequencing of DNA was performed on the Illumina HiSeq 2500 sequencing platform.Exome capture was performed on 500 ng of genomic DNA using nextera rapid capture exome v1.1.The mean depth of the sequence was 90x.Results:There were 12 patients included in indolent group and 8 patients included in aggressive group.The mean depth of tumor tissue were 132X(99-213X).The mean data sizes of tumor tissue were 12.0Gb(9.5-19.1Gb).The mean depth of normal sample were 96X(64-381X).The mean data sizes of normal sample were 8.7Gb(5.8-34.4X).The difference between the two groups were as follow.1.There were 10 top genes in indolent group and 32 top genes in aggressive group.2.The most common mutant gene in indolent group was EGFR.The most common mutant gene in aggressive group was KRAS.3.There were no difference between indolent and aggressive groups in gene indel and copy number variation.4.The patients in indolent and aggressive groups were different according to the clustering analysis based on the top gene.5.It was very hard to separate the indolent patients from the aggressive ones according to the clustering analysis based on the somatic mutant genes and copy number variation.6.The mean number of mutations per sample was 132(range 42 to 287)in aggressive group versus 54(range 26 to 95)in indolent lung cancers(P=0.025).A higher frequency of C>A nucleotide transversion was identified in aggressive lung cancers whereas the C>T transition was the most frequent substitutions in indolent group.Kras mutations were more common in aggressive group(P=0.01)..Pathway analysis using KEGG database showed that more pathways were activated in aggressive group,but none in the indolent group.Based on the GO terms and KEGG annotation,these unigenes of aggressive cancers were highly suggested to be involved in cell adhesion.Conclusion:The work suggests that genomic instability contributes to the poor prognosis of stage I lung adenocarcinoma.The prognosis is associated with the mutation burden and mutational spectrum.The activation of the genes in cell adhesion pathways may predict the recurrence and metastasis of lung cancer.Part 2 The impact of adjuvant chemotherapy on the outcome of early stage patientsAims:A pooled analysis by the LACE collaborative group showed that stage?/? NSCLC patients benefited from adjuvant chemotherapy.However,the observational trial of ICAN conducted in China showed that Chinese early stage NSCLC patients couldn't benefit from adjuvant chemotherapy.We aim to evaluate the role of adjuvant chemotherapy in stage ?/? NSCLC patients.We also explored whether the BIM deletion polymorphism could predict the efficacy of adjutant chemotherapy.Methods:All the stage ?/? NSCLC patients underwent completely resection in Guangdong lung cancer Institute from 2007 to 2011 were enrolled.The stage ?/?patients enrolled in ICAN trial were also included.DNA was extracted from tissue using QIAmp DNA mini kit(Qiagen,Venlo,Netherlands).The Bim deletion polymorphism was detected by polymerase chain reaction(PCR).The forward primer is 5' 6-FAM GCTAACTCAACAAACCCATCAGAAC 3'.The reverse primer is 5'AGCCAGTAAATATAAATCCAAAGCA 3‘.Chi-square or Fisher's exact tests were used to compare qualitative data.Nonparametric tests were used to analyze the quantitative data.Overall survival(OS)was estimated using the Kaplan-Meier method,and the difference in survival between the subgroups was compared using a log-rank test.All analyses were performed using the SPSS 17.0 software program.All statistical tests were two-sided,and P<0.05 was deemed to indicate statistical significance.Results:Six hundred and twenty patients were enrolled,including 375 cases from guandong lung cancer institute and 245 cases from ICAN.We detected the BIM deletion polymorphism in 419 cases.The incidence of the Bim deletion polymorphism was approximately 13.4%in ICAN population,18.3%in guandong lung cancer institute population and 17.2%in overall population.The clinical characteristic factors were balanced between patients received adjuvant chemotherapy and not except that more elder patients received chemotherapy[median 58(21-79)vs 64(28-82),P<0.01].There were 342 cases with adenocarcinoma,89 cases with squamous carcinoma and 32 cases with other type of pathology in patients received adjuvant chemotherapy.There were 128 cases with adenocarcinoma,16 cases with squamous carcinoma and 13 cases with other type of pathology in patients received no adjuvant chemotherapy.Other clinical features,such as gender,smoking,stage,EGFR status and BIM deletion polymorphism were balanced between adjuvant chemotherapy group and no adjuvant chemotherapy.The median DFS were 28.3 and 39.7 months for patients with and without chemotherapy,respectively(P=0.47).The median OS were 62.2 and 72.5 months for patients with and without chemotherapy,respectively(0.37).In subgroup analysis,no DFS or OS difference was observed between patients received adjuvant chemotherapy and not according to BIM polymorphism.The median OS was 72.5 months(95%CI,28.0 to 117.1)in BIM wild type patients with no adjuvant chemotherapy.The median OS was 57.8 months(95%CI,49.9 to 65.7)in BIM wild type patients with adjuvant chemotherapy.The median OS was 28.9 months(95%CI,20.2 to 37.7)in BIM deletion polymorphism patients with no adjuvant chemotherapy.The median OS was 62.7 months(95%CI,36.0 to 89.5)in BIM deletion polymorphism patients with adjuvant chemotherapy.The median DFS was 40.7 months(95%CI,34.5 to 46.8)in BIM wild type patients with no adjuvant chemotherapy.The median DFS was 28.3 months(95%CI,17.5 to 39.1)in BIM wild type patients with adjuvant chemotherapy.The median DFS was 24.5 months(95%CI,0 to 62.5)in BIM deletion polymorphism patients with no adjuvant chemotherapy.The median DFS was 27.0 months(95%CI,10.6 to 43.4)in BIM deletion polymorphism patients with adjuvant chemotherapy.To avoid the interference of EGFR TKIs,we analysis the survival in EGFR wild patients.The median OS was 50.0 months(95%CI,39.6 to 63.2)in BIM wild type patients with no adjuvant chemotherapy.The median OS was 51.4 months(95%CI,44.6 to 58.3)in BIM wild type patients with adjuvant chemotherapy.The median OS was not available in BIM deletion polymorphism patients with no adjuvant chemotherapy.The median OS was 62.7 months(95%CI,48.1 to 78.0)in BIM deletion polymorphism patients with adjuvant chemotherapy.Conclusion:The stage ?/? NSCLC patients in clinical practice may not benefit from adjuvant chemotherapy as in clinical trial.The Bim polymorphism couldn't predict the efficacy of adjuvant chemotherapy and the prognosis of stage ?/?NSCLC the patients.Part 3 The prognosis of uncommon metastases from non-small cell lung cancerBackground:According to the literature and our experience,the most common sites of NSCLC metastases include the brain,bone,liver,adrenal glands,contralateral lung and distant lymph nodes.Metastases to other organs are relatively rare.There have been numerous case reports and a few-small case series of uncommon metastases derived from NSCLC.Methods:We defined all organs except the common metastatic sites mentioned above as uncommon sites of metastasis.Patients with uncommon metastases among 2,872 consecutive NSCLC patients with stage ? disease at the Guangdong lung cancer Institute from 2006 to 2012 were included in this study.The diagnosis of uncommon metastases was based on pathology or imaging studies.Chi-square or Fisher's exact tests were used to compare qualitative data.Nonparametric tests were used to analyze the quantitative data.Overall survival(OS)was estimated using the Kaplan-Meier method,and the difference in survival between the subgroups was compared using a log-rank test.To estimate the risk of OS in the cohort of 2.872 patients,the group(common or uncommon metastasis).age,gender,cigarette smoking history,ECOG PS,pathology and systematic treatment or not were used as covariates in a multivariate Cox regression model.All analyses were performed using the SPSS 17.0 software program.All statistical tests were two-sided,and P<0.05 was deemed to indicate statistical significance.Results:Uncommon metastases were diagnosed in 193 cases at anatomical sites such as the soft tissue,kidney,pancreas,spleen,peritoneum,intestine,bone marrow,eye,ovary,thyroid,heart,breast,tonsil and nasal cavity.Uncommon metastases were identified as independent poor prognostic factors through a multivariate analysis with a HR(hazard ratio)of 1.29[95%confidence interval(Cl)1.09-1.52,P<0.01].Those patients who received systemic therapy plus local treatment had a better survival rate than did those who received systemic therapy only(P<0.01);all patients received best supportive care.Compared with the common metastasis group,the patients in the uncommon metastasis group were more likely have metachronous metastases(P<0.01)and were more likely to be male(P=0.02).Other clinical factors such as age,smoking status,ECOG PS,histology and treatment were balanced between the two groups.The most uncommon metastatic sites,in decreasing order of frequency,were the soft tissue,kidney,peritoneum,spleen,pancreas,intestine,bone marrow,eye,ovary,thyroid,heart,breast,nasal cavity and tonsil.In total,111 cases were diagnosed with synchronous metastases and 82 with metachronous metastases.In the latter group,the median duration between the initial diagnosis of lung cancer and the identification of uncommon metastases was 9.5 months.There were no significant differences in the other patient characteristics,including age,gender,smoking status,ECOG PS,histology and single-lesion or multiple-lesion metastases,between the two groups.There were 84 uncommon metastatic sites diagnosed by pathology,41 by PET/CT,68 by CT,14 by clinical signs,4 by MRI.In the 84 uncommon metastases diagnosed by pathology,71 patients were diagnosed with adenocarcinoma,13 with squamous carcinoma,2 with adenosquamous carcinoma.and 1 with squamous cell carcinoma combined with giant cell carcinoma.The histological features of the metastases were consistent with those of the primary tumors.Overall,64 of the 84 patients had soft tissue metastases,9 had peritoneal metastases,3 had intestinal metastases,1 had bone marrow metastases,and 1 each had kidney,pancreas,ovary,heart,breast,nasal cavity,and tonsil metastases.In uncommon metastasis group,there were 157 patients received systematic treatment and the other 36 patients just received best supportive care(BSC)because of poor PS or poor financial condition.In common metastasis group,there were 2205 patients received systematic treatment and the other 474 patients just received BSC.After the diagnosis of uncommon metastases,112 cases received systemic treatment without local treatment,19 received systemic treatment plus local treatment,and the remaining patients received only BSC.Twelve and seven cases,respectively,in the synchronous and metachronous metastasis groups received local treatment.The systemic treatments included chemotherapy and targeted therapy.The local treatments included surgical extirpation,stereotactic body radiation therapy,and radiofrequency ablation.A total of 151 cases with uncommon metastases died of lung cancer.The median OS(mOS)from the initial diagnosis of lung cancer to death was 13.0 months(95%CI:10.1-15.9 months)in 193 cases.The mOS from the diagnosis of uncommon metastases to death was 5.9 months(95%CI:4.6-7.0 months)in 193 cases.The mOS after the diagnosis of lung cancer was significantly shorter in patients with uncommon metastases versus common metastases(mOS 13.0 months[95%CI:10.1-15.9]vs.18.3 months[17.4-19.2],P<0.01).The 1-year survival rates were 53.9%and 66.0%,respectively.There was no significant difference in survival time after the diagnosis of uncommon metastases between the metachronous and synchronous metastasis groups(mOS 5.5 months[95%CI:3.4-7.6]vs.6.0 months[95%Cl:4.0-8.0].P=0.91).OS was significantly longer among patients who received systemic therapy plus local treatment compared to those who received systemic therapy alone,and those who received BSC(mOS:12.5 months[95%Cl:4.5-20.5]vs.7.4 months[95%Cl:5.2-9.6]vs.3.4 months[95%CI:2.7-4.1];P<0.01)Four of the seven variables mentioned in the "patients and methods" section were found to be independent poor prognostic factors through a multivariate stepwise Cox regression analysis.Uncommon metastases were associated with a hazard ratio(HR)of 1.29,following PS(HR=2.15),no systematic treatment(HR=2.06)and female(HR=1.30).Conclusions:Metastases to the above mentioned sites are infrequent.The presentation of uncommon metastases tends to indicate a poor outcome,and selected patients may benefit from local treatment. |
PDF Full Text Request