Font Size: a A A

CTRP9 Ameliorates Myocardial Lipotoxicity In Obese Mice And The Underlying Mechanism

Posted on:2021-05-02Degree:DoctorType:Dissertation
Country:ChinaCandidate:A J ZuoFull Text:PDF
GTID:1364330602982457Subject:Clinical medicine
Abstract/Summary:
Background:Oxidative stress in cardiac myocytes is an important pathogenesis of cardiac lipotoxicity.Excessive accumulation of saturated fatty acids such as palmitic acid(PA)in cardiac myocytes has been demonstrated to result in myocardial dysfunction and cardiomyocyte apoptosis in obesity and comorbid type 2 diabetes mellitus.Understanding the mechanisms of PA induced cardiac lipotoxicity is very important for developing novel therapeutic strategies to prevent and treat obesity and comorbid type 2 diabetes mellitus.Autophagy is a major intracellular recycling system that maintains cellular homeostasis under basal conditions,and plays an integral role in regulating the cellular adaptive response during stress.Although autophagy has been implicated in the regulation of cardiovascular disorders,its role regulating cardiomyocyte survival during PA induced lipotoxicity in cardiac myocytes remains largely unknown.CTRP9(C1q/TNF-related protein 9),a newly identified paralog of adiponectin,plays pivotal roles in the regulation of lipid metabolism and contributes to cardiovascular protection.It has been demonstrated that the CTRP9 has protective roles in the regulation of obesity,hyperlipidemia and diabetes,indicating that it may ameliorate cardiac lipotoxicity.However,whether and how CTRP9 regulates cardiolipotoxicity is not clear.Objectives:(1)To verify the role of autophagy in palmitic acid(PA)induced cytotoxicity in NRCMs;(2)To explore the protective role in PA induced cytotoxicity in NRCMs;(3)To investigate whether autophagy participates the protection effects of gCTRP9 in PA induced cytotoxicity in NRCMs.Methods:1.Cultures of NRCMs and treatments Primary culture of NRCMs were prepared as described previously[15].NRCMs were incubated in LG-DMEM supplemented with 8%Horse Serum and 5%Fetal Calf Serum for 24 hours after preparation and subsequently the media were replaced with fresh LG-DMEM.Serum-deprived NRCMs were preincubated with recombinant gCTRP9 protein(Aviscera Bioscience,Santa Clara,CA)for 6 hours and then treated with palmitic acid.In some experiments,NRCMs were preincubated with bafilomycin A1(Baf Al,10 nM)for 4h before the cells were harvested.2.Chemical reagents.Recombinant gCTRP9 protein(Aviscera Bioscience,Santa Clara,CA)was dissolved in double distilled water at a concentration of 200 μg/ml;BafAl(Sigma)was dissolved in DMSO at a concentration of 5mM;rapamycin(Sigma)was dissolved in DMSO at a concentration of 1mM.3.Cell viability evaluationNRCMs were seeded in a 24-well plate at a density of 1*105 cells/well.The cell viability was determined using LDH assay(Beyotime,Jiangsu,China)according to the manufacturer’s instructions.4.Cellular ROS productionDetermination of the level of intracellular reactive oxygen species was carried out with a reactive oxygen species assay kit(Beyotime Institute of Biotechnology,Jiangsu,China).NRCMs(4×105cells/mL)were incubated with dihydrodic-hlorofluoresce indiacetate(DCF-DA),delivered in serum-free medium at 37℃ for 30 min,and then harvested in PBS.After loading,the fluorescence images were acquired using a fluorescence microscope(Nikon ELIPSE TE2000-S)in 5min.5.JC-1 stainingMitochondrial membrane potential(△Ψm)was monitored by JC-1,a lipophilic cationic dye that selectively enters the mitochondria.In normal cells with normal △Ψm,JC-1 spontaneously forms complexes known as Jaggregates with intense red fluorescence.In the case of mitochondrial membrane depolarization,the dye remains in its monomeric form with green fluorescence.The JC-1 red:green ratio has been used as a tool to estimate the changes in the △Ψm.The detailed method follows:After removing the culture medium,the cells were rinsed twice with PBS and loaded with lml of fresh medium and 1ml of JC-1 staining for 20 min at 37℃ with 5%CO2,and the supernatant was removed.The cells were then washed twice with JC-1 staining(lx)and we added 2ml of fresh LG-DMEM.We then observed and photographed the cells using a fluorescence microscope(Nikon ELIPSE TE2000-S).6.Evaluation of autophagyAutophagy was assessed by the evaluation of LC3 isoforms,p62 and atg5 protein levels and counting of mRFP and GFP dots.mRFP is resistant to lysosomal acids whereas GFP is not.Therefore,autophagosomes detected by green(GFP)that are not yet fused with lysosomes,whereas those detectable only in red are associated with autophagosomes fused with lysosomes(autolysosomes).These procedures have been previously described.7.Gene transfection and RNAiAccording to the manufacturer’s instructions,NRCMs were transfected 24 hours using transfection reagent riboMONITORTM.For RNA interference,NRCMs were plated and transiently transfected with 100 nM Atg5-specific siRNA or control siRNA.The sequence of ATG 5 sense is 5-GGCCUUUCAUUCAGAAGCUTT-3 and the antisense sequence is 5-AGCUUCUGAAUGAAUGAAAGGCCTT-3.At 48-hour post transfection,the protein levels of Atg5 were determined by Western blotting analysis.8.TUNEL stainingApoptotic cells in vitro and in vivo were detected by use of a commercial DNA fragmentation detection kit(ApopTagPlus Peroxidase In Situ Apoptosis Detection Kit;Millipore,Billerica,MA,USA)according to the mannufacturer’s instructions.9.Western blottingCells were lysed using RIPA buffer(Sigma)and equal amounts of protein were separated on 10%or 12%sodium dodecylsulphate-polyacrylamide gel electrophoresis(SDS-PAGE)and then transferred to PVDF membranes(Millipore,Eschborn,Germany).The membranes were blocked for 1 hours with 5%non-fat milk at room temperature,then incubated overnight at 4℃ with primary antibodies specifically against p62(Cell Signaling Technology,CST),Atg5(Sigma)and cleaved caspase-3(CST),LC3 from Proteintech.10.Statistics.All statistical analyses were performed using SPSS 17.0.For statistical analysis,Student’s t-test and one-way ANOVA were performed,wherever applicable.Statistical significance was set to p<0.05 and the data are represented as mean SEM.Results:1.Palmitic acid causes cytotoxicity in NRCMs(1)Treatment with palmitic acid resulted in a strong ROS level in NRCMs compared with vehicle-treated cells in a dose-dependent manner.(2)Treatment with palmitic acid decreases mitochondrial membrane potential(△Ψm)in NRCMs compared with vehicle-treated cells in a dose-dependent manner(3)Palmitic acid decreased cell viability in NRCMs in a time and dose dependent manner.2.Impaired autophagic flux induced by palmitic acid contribute to cytotoxicity in NRCMs(1)Treatment with palmitic acid for 24h induces the accumulation of autophagosomes,but block autophagic flux in NRCMs.(2)The autophagic defect induced by PA contribute to cytotoxicity in NRCMs.3.Treatment with globular CTRP9 induces autophagy in NRCMs(1)Western blotting revealed gCTRP9 induces the accumulation of autophagosomes,and promotes autophagic flux in NRCMs.(2)NRCMs transfected with LC3-mRFP-GFP lentivirus were incubated for 72h.We found both yellow dots and red dots were observed after treatment with gCTRP9 for 24h compared with the vehicle-treated NRCMs indicating enhanced autophagy in NRCMs incubated with gCTRP9 for 24h compared with vehicle-treated cells.4.Globular CTRP9 induces autophagy in the presence of palmitic acid in NRCMs Compared with the control group,we found gCTRP9 upregulated autophagy in cardiomyocytes subjected to palmitic acid,as indicated by increases in ratio of LC3II/I and decreases in p62 and by a significant increase in red fluorescent protein-LC3 in NRCMs transfected with LC3-mRFP-GFP lentivirus.5.Globular CTRP9 reestablished the loss of mitochondrial membrane potential,suppressed ROS Generation,and reduced palmitic acid-induced myocyte death(1)JC-1 staining indicated that the decreased mitochondrial membrane potential(△Ψm)triggered by palmitic acid was partially restored preincubated with gCTRP9,suggesting that gCTRP9 can ameliorate palmitic acid-induced apoptosis in NRCMs(2)In this experiment,we also observed that pretreatment with gCTRP9 alleviated palmitic acid induced ROS in NRCMs.(3)To further clarify the protective role of gCTRP9 in palmitic acid-induced toxicity,cleaved caspase 3,a classic marker of cell apoptosis,was measured by western blotting.We found gCTRP9 treatment attenuated palmitic acid of different concentrations induced apoptosis in NRCMs.6.ATG5 knockdown partly eliminated the protective effect of gCTRP9 on thecardiac lipotoxicity(1)Viability assay revealed that suppression of autophagy by ATG5 siRNA partially abolished the increased survival triggered by gCTRP9 in palmitic acid-induced NRCMs,suggesting that gCTRP9 can ameliorate palmitic acid-induced toxicity by the modulation of autophagy in NRCMs.(2)In addition,ATG5 knockdown also restored palmitic acid-induced ROS level in the presence of gCTRP9(3)Furthermore,suppression of autophagy by ATG5 siRNA inhibited gCTRP9 induced attenuation of Caspase 3 cleavage and apoptotic cells in palmitic acid-treated NRCMs.Conclusion(1)Impaired autophagic flux induced by palmitic acid contribute to cytotoxicity in NRCMs.(2)Globular CTRP9 induces autophagy in the absence and presence of palmitic acid in NRCMs.(3)Globular CTRP9 alleviates palmitic acid-induced lipotoxicity in NRCMs.(4)The protective effect of gCTRP9 on the cardiac lipotoxicity is dependent on upregulation of autophagy.Background:Obesity is among the major risk factors for myocardial structural and functional changes,leading to high cardiovascular morbidity and mortality.Several mechanisms that elicit obesity related cardiomyopathy have been proposed.Cytokines produced by the expanded adipose tissue,such as leptin and resistin,and triglyceride accumulation induce cardiac dysfunction.Another proposed mechanism is excess supply of saturated fatty acids(FAs),such as palmitic acid.Unoxidized FAs in cardiac myocytes could produce oxidative stress and ER stress,resulting in lipotoxicty.Oxidative stress and ER stress-initiated apoptotic signaling pathway play crucial roles in the pathogenesis of obesity-induced cardiac abnormality.AMP-activated protein,kinase(AMPK)is a major cellular sensor of energy balance in mammalian cells.Liver kinase B1(LKB1)can act as major upstream kinases of AMPK and phosphorylate AMPK at Thr172.Under normal physiological condition,LKB1 is predominantly localized in the nucleus.Under some conditions,LKB1 is phosphorylated at Ser428(pLKB1)and then translocated to the cytosol,subsequently induces activation of AMPK.Although several lines of evidence demonstrate that AMPK phosphorylation is attenuated in diet induced obesity(DIO)mouse hearts,the mechanisms by which AMPK phosphorylation is decreased are not fully elucidated.C1q/TNF-related protein 9(CTRP9)is the closest paralog of adiponectin,initially identified as an adipokine modulating metabolic and cardiovascular function Recently CTRP9 was reported to be abundantly produced in the heart suggesting it perhaps plays a more critical role in myocardium than APN.Several reports indicate that CTRP9 alleviates myocardial ischemia/reperfusion(MI/R)injury,reverses post-MI remodeling and promotes vasodilatation.However,CTRP9 was also shown to trigger hypertrophic cardiac remodeling and dysfunction in response to pressure overload.The discrepancy in the regulation of myocardial function by CTRP9 remains unclear.In addition,CTRP9 has been investigated to increase mitochondrial biogenesis and muscle fat oxidation suggesting it may also regulate lipid metabolism.Nervertheless,whether the protective effects of CTRP9 in HFD induced cardiac hypertrophy and lipotoxicity is unknown.Objectives:(1)to determine the functional role of CTRP9 in HFD-induced cardiac lipotoxicity;(2)to investigate whether CTRP9 regulates myocardial hypertrophy and function in DIO mice;(3)to elucidate the underlying mechanisms responsible for the actions of CTRP9 upon cardiac lipotoxicity.Methods:1.Mice and dietsThe experimental procedure was approved by the Institutional Ethics Committee of Shandong University and was in compliance with the Guide for the Care and Use of Laboratory Animal published by the US National Institutes of Health and Shandong University.The CTRP9-knockout(on a C57BL/6J background)mice were generated by Shanghai Biomodel Organism Science&Technology Development Co.,Ltd.WT and CTRP9-KO mice were grown by normal chow(NC)feeding until they were 8 weeks old,after which they were randomly assigned to normal chow diet or a high fat(60%of total calories from fat)diet for additional 26 weeks.2.Echocardiographic assessmentMice were anesthetized with 1.5%isoflurane and echocardiographic images were evaluated using the VEVO770 imaging system(VisualSonics,Toronto,ON,Canada)as described previously.Adequate depth of anesthesia was monitored using toe reflex.The heart was imaged in the 2-D mode in the parasternal long axis view with a depth of 2 cm.The left ventricular ejection fraction(LVEF),left ventricular fractional shortening(LVFS),left ventricular end-diastolic diameter(LVEDd),left ventricular posterior wall thickness(LVPWd)were measured by M type ultrasound.Heart rate was averaged over 10 cardiac cycles.3.Cardiac histological analysisMouse heart tissues were harvested,washed,and then fixed with immediately fixed in 4%paraformaldehyde and embedded in paraffin.Heart sections were stained with Oil red O to measure triglyceride(TG)content.To evaluate the cross-sectional area,WGA staining was examined.To detect interstitial collagen deposition,heart sections were stained with Masson’s trichrome.To monitor oxidative stress status,deparaffinized sections were stained with 4-HNE and frozen heart sections were stained with DHE.Immunofluorescence was performed for detecting the expressions of CHOP and GRP78 to assess ER stress in vivo.At least five mice per group were used for these experiments.4.RNA isolation and real-time PCR assaysTotal RNA was extracted using Trizol(Invitrogen,Carlsbad,CA)according to the manufacturer’s instructions.Total RNA(1 mg)was reverse-transcribed using an oligo(dT)16 primer to obtain cDNA.The cDNA was amplified by polymerase chain reaction(PCR).Real-time PCR was performed with a Light Cycler 1.5 apparatus(Roche,Mannheim,Germany)using a Light Cycler DNA master SYBR green-I kit according to the manufacturer’s instructions.The expression of target mRNA was normalized to GAPDH.5.Cultures of NRCMs and treatmentsPrimary culture of NRCMs were prepared as described previously.NRCMs were incubated in LG-DMEM supplemented with 8%Horse Serum and 5%Fetal Calf Serum for 24 hours after preparation and subsequently treated with a lentivirus vector containing LKB1-siRNA at a multiplicity of infection(MOI)80 for 48 hours.The target sequence for LKB1 siRNA was TATCTACAAGCTCTTTGAGAA and negative control sequence was TTCTCCGAACGTGTCACGT.Thereafter the media were replaced with fresh DMEM without lentivirus.Serum-deprived NRCMs were preincubated with recombinant gCTRP9 protein(Aviscera Bioscience,Santa Clara,CA)for 6 hours and then treated with palmitic acid.In some experiments,NRCMs were treated with compound C(10μM)prior to gCTRP9 protein or vehic.le treatment6.Cell viability and cell injury evaluationNRCMs were seeded in a 24-well plate at a density of 1*105 cells/well.The cell viability was determined using MTT assay(Beyotime,Jiangsu,China)as previously reported.The cell damage was assessed by determining the release of LDH from the cells using a LDH Detection Kit(Beyotime,Jiangsu,China)according to the manufacturer’s instructions.7.Cellular ROS productionDetermination of the level of intracellular reactive oxygen species was carried out with a reactive oxygen species assay kit(Beyotime Institute of Biotechnology,Jiangsu,China).NRCMs(4x 105cells/mL)were incubated with dihydrodichlorofluoresce indiacetate(DCF-DA),delivered in serum-free medium at 37℃ for 20 min,and then harvested in PBS.Cells treated with Rosup(50μg/ml)for 20 min were used as positive controls.After loading,the fluorescence images were acquired using a fluorescence microscope(Nikon ECLIPSE TE2000-S)in 2 min.8.TUNEL stainingApoptotic cells in NRCMs and myocardium in mice were detected by use of a commercial DNA fragmentation detection kit(ApopTagPlus Peroxidase In Situ Apoptosis Detection Kit;Millipore,Billerica,MA,USA)according to the mannufac-turer’s instructions.Briefly,NRCMs were fixed with 4%paraformaldehyde for 30 min.at room temperature.Mice heart tissue sections were deparaffinized and hydrated.The samples underwent 20 ug/ml proteinase K for 5 min.and were washed with PBS.Then,samples were incubated with 3%H2O2 for 15 min.After adding the equilibration buffer,samples were incubated with TdT enzyme at 37℃ for 1 h.The samples were then incubated with antidigoxigenin conjugate at room temperature for 30 min.Peroxidase substrate was applied to detect apoptotic cells,stained brown and normal cells appeared green(0.5%methyl green-pyronin).9.Preparation of cytosolic and nuclear extractsNuclear-cytoplasmic fractionation was extracted using Nuclear and Cytoplasmic Protein Extraction Kit(Beyotime,Shanghai,China)according to the manufacturer’s protocol.In brief,NRCMs were harvested and suspended with cytosolic proteins extraction agent A,then incubated on ice for 15 min followed by adding cytosolic proteins extraction agent B.After centrifugation at 4℃ for 5 min,the supernatant was cytosolic proteins and the precipitate was suspended with nuclear proteins extraction agent.After centrifugation at 4℃ for 10 min,the supernatant was nuclear proteins.10.Analysis of subcellular localization by microscopyNRCMs were cultured on glass coverslips in a 24-well plate.For LKB1 analysis,NRCMs were treated with CTRP9(1ug/ml)for 0,7.5 and 15 min.Cells were incubated overnight at 4℃ with primary antibodies for LKB1(Santa Cruz Biotechnology)in PBS with 0.1%Triton X-100 in a humidified chamber.Cells were washed with PBS and incubated with secondary antibody(1:200 dilution;Cell Signaling Technology,Beverly,MA,USA)for 30 min.at 37℃.Fluorescent images were acquired by laser scanning confocal microscopy(LSM710;Zeiss,Jena,Germany).11.Western blot analysisEqual amounts of protein were separated on 10%or 12%sodium dodecylsulph ate-polyacrylamide gel electrophoresis(SDS-PAGE)and then transferred to PVD F membranes(Millipore,Eschborn,Germany).The membranes were blocked for 1 hours with 5%non-fat milk at room temperature,then incubated overnight at 4℃ with primary antibodies specifically against Grp78(Abcam),CTRP9(Avisce ra Bioscience,CA),cleaved caspase 12(OmnimAbs,USA),4-HNE(Abcam),m-T OR(Abcam),p-MTOR(Abcam),LKB1(Cell Signaling Technology and Santa Cruz Biotechnology),pLKB1(Ser428)(Santa Cruz Biotech-nology),histone H3,cleav ed caspase-3,parp,tubulin,β-Actin,CHOP,t-AMPK,p-AMPK(Thr172)all fro m Cell Signaling Technology.After being washed three times,the membranes were incubated with respective anti-rabbit IgG(Abcam)and anti-mouse IgG(Ab cam)for 60 min.at room temperature.Protein contents were visualized using an enhanced chemiluminescent reagent(Bio-Rad,Hercules,CA,USA).12.Statistical analysisMeasurements are presented as means ±SEM(standard error of the mean).Differences between two groups were performed by unpaired t-test,and multiple groups involved one-way ANOVA.Differences were considered statistically significant at P<0.05.SPSS 17.0(SPSS,Chicago,IL,USA)was used for statistical analysis.Results:1.CTRP9 deficiency accentuated HFD-induced glucose and lipid metabolism disorderAfter 26 weeks of high-fat diet,compared with the WT-NC group,the circulating and cardiac CTRP9 levels in the WT-HFD group were significantly reduced(P<0.05).Compared with the WT-HFD group,the CTRP9KO-HFD group had significantly increased body weight and liver weight increased significantly in the CTRP9KO-HFD group(P<0.05).At the same time,we observed that compared with the WT-HFD group,the CTRP9KO-HFD group had lower glucose tolerance and less insulin sensitivity(P<0.05).In addition,compared with the WT-HFD group,the serum triglycerides(TG)and free fatty acids(FFA)of CTRP9KO-HFD mice were much higher(P<0.05).We also found that high-fat diets can lead to TG accumulation and up-regulation of fatty acid synthase and total ceramide and CTRP9 knockout further exacerbated the above effects(P<0.05).2.CTRP9 knockout aggravated HFD-induced myocardial hypertrophy and fibrosisEchocardiographic analysis was performed after 26 weeks of low-fat diet or high-fat diet.We found that HFD feeding could significantly increase cardiac hypertrophy including left ventricular posterior wall thickness(LVPWd)and interventricular septal thickness(IVSTd)(P<0.05),but did not cause cardiac systolic dysfunction(P>0.05).Compared with the WT-HFD group,the LVPWd and IVSTd in the CTRP9KO-HFD group significantly increased(P<0.05),suggesting that myocardial hypertrophy was significantly increased.The results of WGA staining and the ratio of heart weight to tibia length were further verified(P<0.05).In addition,compared with the WT-HFD group,cardiac fibrosis was significantly worse in the CTRP9KO-HFD group(P<0.05).3.CTRP9 knockout exacerbated ER stress related apoptosis in the heart of HFD-fed miceWestern blot showed that compared with WT-HFD group,the expression of GRP78,CHOP,cleaved caspase 12,cleaved caspase 3 and PARP in myocardial tissue of CTRP9KO-HFD group significantly increased(P<0.05).Consistent with Western blot results,immunofluorescence showed that compared with the WT-HFD group,GRP78 and CHOP of cardiac tissues in the CTRP9KO-HFD group significantly increased(P<0.05).TUNEL staining showed that compared with the WT-HFD group,myocardial apoptotic cells in the CTRP9KO-HFD group significantly increased.The above results indicate that CTRP9 knock-out could aggravate myocardial endoplasmic reticulum stress-related apoptosis induced by a high-fat diet in mice.4.CTRP9 treatment ameliorated palmitate induced ER stress related apoptosis in NRCMsLDH release and MTT test demonstrated that PA can induce lipotoxicity of NRCMs in a concentration-dependent manner(P<0.05).Western blot experiments were further verified by detecting apoptosis indicators(P<0.05).LDH release test showed that CTRP9 could improve PA-induced NRCMs cell viability.Western blot experiments showed that compared with the PA group,the expressions of GRP78,CHOP,cleaved caspase 12,cleaved caspase 3,and PARP in the PA+CTRP9 group were significantly reduced(P<0.05).TUNEL staining showed that compared with PA group,NRCMs apoptotic cells in PA+CTRP9 group were significantly weakened(P<0.05).The above results show that exogenous CTRP9 could improve PA-induced ER stress-related apoptosis.5.CTRP9 deficiency exacerbated oxidative stress in the heart of HFD-fed mice In vitro experiments demonstated that exogenous CTRP9 alleviated PA-induced ROS in NRCMs in a concentration-dependent manner(P<0.05).In vivo experiments showed that compared with the WT-HFD group,the expression of 4HNE in the heart tissue of mice in the CTRP9KO-HFD group was significantly reduced(both immunohistochemistry and western blot)(P<0.05).The results of dihydroacetimidine(DHE)staining were further verified(P<0.05).The above results show that CTRP9 can reduce the myocardial oxidative stress induced by lipotoxicity.6.AMPK phosphorylation is weakened in HFD-fed CTRP9 knockout Mice and palmitate-treated NRCMs Compared with the WT-NC group,the pAMPK expression in the heart of the WT-HFD group was significantly reduced,and the expression of p-mTOR significantly increased(P<0.05),which is consistent with the results of in vitro experiments(P<0.05).In addition,exogenous CTRP9 promoted pAMPKphospho-rylation in a time-dependent manner(P<0.05).The western blot results showed that compound C,an AMPK blocker,attenuated the protective effect of CTRP9 on PA-induced NRCMs apoptosis to some extent.The above results indicate that AMPK is involved in the improvement of myocardial lipotoxicity by CTRP9.7.LKB1-dependent AMPK activation by CTRP9 in NRCMsWe observed CTRP9 could enhance the expression of pLKB1 in NRCMs in a time-dependent manner(P<0.05).Lentivirus knockdown of LKB1 significantly reduced activation of pAMPK in NRCMs by CTRP9(P<0.05).LDH release tests showed that knockdown of LKB1 by lentivirus significantly reduced the protective effect of CTRP9 on the lipotoxicity of PA-induced NRCMs(P<0.05).Immunofluorescence staining and western blotting experiments domonstrated CTRP9 could promote the translocation of nuclear LKB 1 to the cytoplasm(P<0.05).The above results indicate that the activation of LKB1/AMPK pathway plays an important role in ameliorating cardiac lipid toxicity by CTRP9.ConclusionCTRP9 exerts anti-myocardial lipotoxicity properties and inhibited cardiac hypertrophy probably through the LKB 1/AMPK signaling pathway.
Keywords/Search Tags:CTRP9, cardiac lipotoxicity, autophagy, oxidative stress, lipotoxicity, obesity, LKB1/AMPK
Related items