| Background&Aim:The extent of adverse myocardial remodeling contributes to the the prognosis after myocardial infarction(MI).Autophagy has been shown to be an adaptive response of the heart,but the effects of YQHX-herbs,a clinic effective traditional Chines medicine,remain unclear after MI.In this study,we investigated whether YQHX-herbs attenuates cardiac remodeling by autophagy after MI.Ischemic heart disease is one of the leading cause of morbidity and mortality worldwide.Due to improvement of therapeutic strategies after myocardial infarction(MI),mortality decreased significantly in the past decades.There is also an increasing number of patients whose prognosis depends on optimal treatment after MI.Despite the widespread use of angiotensin-converting enzyme inhibitors,beta-blockers,and aldosterone-antagonists,the incidence of heart failure as the end-stage of cardiac remodeling remains high.Acute myocardial infarction can induce molecular,biochemical,cellular,and interstitial alterations that change the structure and geometry of the left ventricle(LV)in a process known as cardiac remodeling,which is associated with ventricular dysfunction.Underlying mechanisms of remodeling are multiple,including activation of physical and neurohumoral processes as well as activation of growth factors and the protein translation machinery.Moreover,many other factors,including late death or hypertrophy of cardiomyocytes,fibrosis,expression of various cytokines,and non-myocyte dynamics within the infarct tissue,are all associated with disease progression during the chronic stage.Autophagy is an intracellular process where a cell digests its own constituents,including subcellular organelles(e.g.mitochondrion),via the lysosomal degradative way.Autophagy has survival-oriented functions,occurring under both basal conditions and cellular stress(e.g.starvation).In the heart,autophagy occurs constitutively in the normal myocardium but is substantially reinforced under cardiac hypertrophy,ischemic cardiomyopathy,or heart failure.Inefficient autophagy or its absence causes poor heart performance,while inhibition of starvation-induced autophagy results in cardiac dysfunction and dilatation.Moreover,autophagy has been shown to be an adaptive response of the heart that protects the myocardium from acute ischemic death and homeostasis.On the other hand,autophagy is also a mode of cell death that occurs to eliminate unnecessary cells during tissue and organ development.The functional role of autophagy in heart disease and cellular function are still poorly understood.Traditional Chinese medicine(TCM)has been playing an essential role in health maintenance for a wide range of chronic diseases like cardiovascular diseases and cancers.TCM-derived compounds and extracts attract attention for their potential application as therapeutic agents against these diseases.Autophagy,as a promising drug target,can be modulated by various TCM-derived agents,indicating autophagy modulation may be an efficient mechanism underlying the therapeutic effect of TCM in treating diseases.The "mammalian target of rapamycin"(mTOR)is mainly activated via the Akt/PI3K pathway that the signaling mechanism is centrally involved in physiological hypertrophy but also takes part in pathological remodeling of the heart.Inhibition of mTOR can prevent adverse LV remodeling post-MI.AMPK,which is strongly activated during energy deprivation and other types of cellular stress,is usually inhibited under these conditions,suggesting that it is involved in a main intracellular mechanism leading to mTOR activation.Several TCM-derived compounds and extracts can protect cardiomyocytes and adverse remodeling via Akt/mTOR or AMPK/mTOR such as WenxinKeli,Tongxinluo,Xuefuzhuyu,Rensheng and Hongjingtian.Yiqihuoxue herbs(YQHX-herbs)decoction,a clinic effective TCM,is shown to repair energy metabolism disorders and protect cardiomyocytes via Akt/mTOR or AMPK/mTOR pathway in previous studies.In this study,we aim at investigating whether YQHX attenuates cardiac remodeling by autophagy after MI.To address this issue,myocardial infarction model is used to observe autophagy in the heart during the subacute and chronic stages(7 days and 28 days after coronary occlusion)and examine the effects of agents that alter the autophagic process on the progression of post-infarction cardiac remodeling and dysfunction.Methods:YQHX treatment was initiated on the day after induction of MI in rats for subacute(7 days)and chronic(28 days)stages.The investigation conforms to the guide for the care and use of laboratory animals published by the U.S.National Institutes of Health(NIH Publication No.85-23,revised 1996)and was approved by the authorities of the Institutional Animal Research Committee of Dongzhimen Hospital of Beijing University of Chinese Medicine(approval number:17-11).We used healthy male Sprague-Dawley(SD)rats(Beijing Vital River Laboratory Animal Technology Co.Ltd.,China;production license No.SCXK(Beijing)2016-0006)with a weight of 200 ±20g from 8 to 10 weeks.Animals were housed in a temperature-controlled environment with a 12-h light/dark cycle where they receive food and water ad libitum.To observe the development of cardiac remodeling and autophagy during subacute stage(7 days)and chronic stage(28 days)of infarction,we analyzed the hearts after surgery.Animals surviving 24 hours after surgery and electrocardiogram(ECG,Medical electronic instrument factory,Shanghai,China)examination were randomly assigned to groups in both stages:a sham-operated(vehicle-treated)group(S),a model(vehicle-treated)group(M),a YQHX-treated group(8.2 mg/kg/day)(Y),a combination of Chloroquine(CQ,10mg/kg intraperitoneal injection 30 min before surgery)and model group(M+CQ),a combination of CQ and YQHX group(Y+CQ).The Chinese herbal formula YQHX(Patent application number:CN:201610368030:A).consists of qi supplementing herbs and blood circulation activating herbs in a 2:1 ratio.Qi supplementing herbs include Huangqi(Astragalusmongholicus Bunge)and Rensheng(Panax Ginseng C.A.Mey).Blood circulation activating herbs include Danggui(Angelica Sinensis(Oliv.)Diels.),Chuanxiong(Ligusticum chuanxiong Hort)and Sanqi(PanaxNotoginseng(Burk.)F.H.Chen).All crude herbs were provided by the Pharmacy Department of Dongzhimen Hospital of Beijing University of Chinese Medicine and confirmed by pharmacognostic experts.Aqueous YQHX extracts were prepared under standardized procedures.Briefly,herbs were extracted continuously refluxing with boiling distilled water for three times per hour(10-folds,8-folds,8-folds volume of water respectively).The filtered solutions were combined and concentrated into the resulting aqueous extracts containing 2 g/mL raw herbs.The preparation was frozen at-20? before usage.Chloroquine is an anti-inflammatory drug which has been used in the treatment of malaria for more than 70 years,which isconsidered to raise lysosomal pH and inhibiting lysosomal activity.Since autophagosome-lysosome fusion is pH-dependent,the alkalinizing effects of CQ on lysosomes inhibit fusion and hydrolase activity,thus preventing autophagic vacuoles(AVs)clearance.Treatments were administered by daily oral gavage for 7 days or 28 days.The YQHX treatment with a dose of 8.2 mg/kg/day has been established to be efficacious and well-tolerated in previous studies.Vehicle is double distilled water(DDW).Chloroquine(50mg,Selleck)solution in DDW to administer at 10mg/kg(1mg/mL for average 100g,maximum solubility is 100mg/mL in water).For basic characterization including electrocardiogram and echocardiography measurements,animals were killed 7 days or 28 days after MI.For killing,anesthesia was induced by intraperitoneal injection(IP)of 1%pentobarbital sodium(50 mg/kg)and basic measurements were performed.The heart was then arrested in diastole by injection of saturated potassium chloride solution.After dissecting the LV,myocardial samples from border zone of LV were snap frozen for biochemical measurements or fixed in formalin for further histological evaluation.For the MI model,animals were anesthetized by IP of 1%pentobarbital sodium(Chemical Reagent Beijing,Beijing,China).After orotracheal intubation and ventilation,the thorax was opened left parasternally,and MI was induced by permanently ligating the left anterior descending(LAD)coronary artery just below the left atrial appendage.We use a rodent ventilator(Kent Scientific Corp,Torrington,CT,USA)with 65%oxygen during the surgical procedure.The quality of the infarction was confirmed visually by the color change of the myocardium.We confirm regional ischemia by ST-T changes in an ECG.Sham-operated animals underwent the same surgical procedures except that the LAD coronary artery was not occluded.Echocardiography was performed in a modified configuration as previously described in detail.Studies were recorded with the Vevo770 high-resolution imaging system echocardiography machine(Visual Sonics Inc.,Toronto,Canada).The M-mode measurements of LV dimensions were averaged from more than 3 cycles.The investigator who conducted the echocardiography was blinded from the treatment status.Once the physiological measurements were complete,animals were sacrificed and histological studies were conducted with formalin-fixed,paraffin-embedded hearts from animals of all groups.Cross sections of the LV obtained midway between base and apex were cut into 4 mm thick sections and stained with hematoxylin-eosin.Cardiomyocyte size(expressed as the transverse diameter of myocytes cut at the level of the nucleus)was assessed in 7 randomly chosen high-power fields(HPFs;400×)in each section and measured with the Image J software(Image J,NIH,Bethesda,Maryland).We investigated autophagic flux in vivo,according to the previously described method by Buss et al.and Zhang.After surgery,the animals were randomized for treatment with YQHX or vehicle.Cardiac tissue was quickly cut into 1 mm cubes,immersion fixed with 2.5%glutaraldehyde in 0.1 mol/L phosphate buffer(pH 7.4)overnight at 4?,and post-fixed in 1%buffered osmium tetroxide,as previously reported.The specimens were then conventionally processed and examined under an electron microscopy(H-800,Hitachi).For further biochemical analysis,animals were killed 7 and 28 days after MI.Proteins extracted from hearts(n=7 from each group)were prepared from the LV tissue of the border area.The border area was defined as the area containing both infarction and surviving myocardium within a HPF,while the remote area was the myocardial region remote from any infarction.Western blot analysis of lysates of the rat hearts were performed as described previously.?-actin served as the loading control.Primary antibodies used were Beclin 1(Abeam),LC3B(Abeam),p62(Cell Signaling Technology,Inc.),Cathepsin D(Santa Cruz Biotechnology,Inc.),ANP(Abeam),mTOR(Abeam),p-mTOR(Abeam).Real-time polymerase chain reaction(PCR)was performed according to the RT-PCR kit instructions.Additionally,primers were designed and synthesized by Beijing Dingguochangsheng Biotechnology Co.,Ltd(Beijing ICP certificate NO.030173).Primers were as follows:ANP(235 bp)-sense:5'GAGCGAGCAGACCGATGAAG,antisense:3'CTGGGCTCCAATCCTGTCAAT;GAPDH(141 bp)-sense:5'GGCAAGTTCAACGGCACAG,antisense:3'GCCAGTAGACTCCACGACAT.PCR conditions were as follows:initial melting at 95? for 3minutes followed by 35 cycles of denaturation at 95? for 15 seconds,annealing at 63 ? for 30 seconds,and extension at 72 ?for 30 seconds.The PCR was the given a final extension step of 72? for 7 minutes.The transcripts were checked subsequently using 2%agarose gel electrophoresis,and integrated optical density was presented by the ratio of ANP and GAPDH.The results are expressed as mean ± standard error(SEM).Statistical analysis was performed via SPSS 17.0(IBM,Chicago,USA)and the Graph-Pad Prism Software Package(Graph-Pad,Inc.,San Diego,California).Differences between groups were tested by one-way analysis of variance with post hoc comparisons by Dunnett's post hoc test and paired or unpaired Student t-test where appropriate.The differences between groups were tested by 2-way analysis of variance.Values of P<0.05 were considered significant.Results:YQHX-herbs treated animals had reduced post-MI remodeling,with improved left ventricle(LV)function and smaller LV internal end-systolic diameter,LV end-systolic volumes,and cardiac myocyte size in chronic stage.Measurement of autophagic flux demonstrated that YQHX-herbs accelerated autophagic turnover in subacute stage.The main finding of this study is that the TCM of YQHX can prevent adverse cardiac remodeling through augmenting autophagy after MI.Of note,medication in this study was initiated on the day after induction of myocardial infarction,as is the case in a clinical setting.At a clinically relevant dose,YQHX effectively attenuated infarction-induced remodeling.Up-regulation of autophagy acts as a protective mechanism in the failing heart.Since myocardial blood flow is permanently discontinued in the central region of the infarct zone due to ligation of the corresponding coronary artery,it is obvious that reduction of infarct size must be a result of a specific process in the border zone.Beclin-1 is critical to the 'nucleation phase' of autophagy,which promotes LC3B-I to the activated form LC3B-?.LC3B-? localizes to the autophagosome membrane,where it promotes formation of autophagosomes enabling elongation of the limiting membrane.Autophagosomes,degrading cargo adaptors such as p62 via autophagy,deliver proteins and organelles to lysosomes for degradation.The study showing YQHX activate autophagy especially in subacute stage post-MI.The myocardial LC3B-II/-I ratio is an established indicator of autophagic turnover.The LC3-binding protein p62 regulates the formation of protein aggregates and is removed by autophagy,while cathepsin D is a lysosomal proteolytic enzyme,and both participate in the digestion steps during autophagy.Our study demonstrating YQHX accelerated autophagic turnover indicate that autophagy is activated within surviving cardiomyocytes in the infarcted heart in subacute stage of MI.Inhibition of autophagy aggravates post-MI cardiac dysfunction and remodeling during subacute and chronic stages following coronary occlusion in surviving wild-type mouse hearts,whereas in our study,the inhibitor of autophagy is applied only in surgery.The effect of YQHX treatment by autophagy may be counterbalanced by CQ after MI.Protein and gene expression of ANP in cardiomyocytes in the border area was augmented by infarction especially in CQ treatment in both subacute and chronic stage.The YQHX-treated group in subacute stage were higher than chronic stage,but no difference has been observed between two stages in the M group.The YQHX treatment reduces the ANP expression and decreases myocardial hypertrophy.As noted earlier,a cornerstone of autophagy control is the activity of the mTOR.Rapamycin(a mTOR inhibitor drug)inhibits mTORC1 and results in an increase in autophagic flux.The role of mTOR inhibition,such as rapamycin and sirolimus,in an in vivo model which allows investigation of long-term course and chronic remodeling effects.As mentioned in the preceding text,mTOR-phosphorylation is reduced in YQHX-treated animals,thereby dis-inhibiting its anti-growth properties.Obviously,these effects that are modulated by YQHX can protect the heart from adverse remodeling effects.The ratio of p-mTOR/mTOR reflected the activating state on the protein kinase mTOR.The YQHX-treated group activated autophagy in both stages especially in 7 days after MI,whereas the vehicle-treated model group inactivated autophagy in subacute stage and significant activated protein synthesis in chronic stage.We have no idea why at the chronic stage the combination of CQ groups becomes activated the protein kinase mTOR.Conclusion:Augmenting autophagy with Yiqihuoxue herbs(YQHX-herbs)decoction could be a therapeutic strategy to attenuate adverse cardiac remodeling after MI.These data suggest that the beneficial effects of YQHX after MI stem from reducing hypertrophy and increasing autophagy.YQHX-treated animals had reduced post-MI remodeling,with improved LV function and smaller LV internal end-systolic diameter,LV end-systolic volumes,and cardiac myocyte size in chronic stage.Measurement of autophagic flux demonstrated that YQHX accelerated autophagic turnover in subacute stage.The YQHX treatment activated autophagy in subacute stage and regulated restrain on protein synthesis in chronic stage by mTOR.Finally,YQHX,as a complementary and alternative medicine,augmenting autophagy could be a therapeutic strategy to attenuate adverse cardiac remodeling after MI. |
PDF Full Text Request