Font Size: a A A

Population Surveillance, Current Status And Mechanisms Of Insecticide Resistance Of Themalaria Vector Anopheles Mosquito In Hainan Island

Posted on:2015-02-20Degree:DoctorType:Dissertation
Country:ChinaCandidate:Q QinFull Text:PDF
GTID:1264330431469229Subject:Pathogen Biology
Abstract/Summary:PDF Full Text Request
Background:Malaria is a significant public health problem and impediment to socioeconomic development in world. So far, malaria is no longer a non-preventable disease. Vector control is a fundamental element of the existing global strategy to fight malaria. Use pyrethroid treated bed nets and indoor residue sprays insecticides are the main components of malaria control strategies. However, these practices have resulted in pyrethroid resistance, and greatly reshaped the mosquito community and population structures. In order to completely eliminate malaria, study the mechanism of malaria vector insecticide resistance is imperative.As we all know, study on the mechanism of Pyrethroids resistance of mosquitoes include two categories:metabolic detoxification and reduced sensitivity of the target. Metabolic resistance mainly through in metabolic enzyme gene of malaria vector insecticide-resistance mosquito vivo amplification or over-expression, enhance the activity of metabolic enzyme, thereby degrading pesticide toxicity and blocking the insecticides arrived to resistant insects target. Such as cytochrome P450oxidase (P450s), non-specific esterase system (ESTs) and glutathione S-transferase (GSTs) are the main metabolic detoxification enzymes. Target resistance mainly refers to mutations in target gene of malaria vector insecticide-resistance mosquito, reduce its combination with insecticides and result reduce the malaria vector sensitivity to insecticide, then produces insecticide resistance. There are3main target insecticide actions:the target of organophosphate and carbamate insecticides is acetylcholinesterase (AChE); DDT and pyrethroid insecticides target is the para-type sodium channel (SC); target of cyclopentadienyl and pyrazole kind, Bicyclic phosphate ester kind, Bicyclic benzoate kind insecticides are γ-aminobutyric acid (GABA) receptor chloride ion channel complex.In China, Plasmodium falciparum malaria is mainly found in two tropical provinces, Hainan and Yunnan. Hainan Island, separated by the30km-wide Qiongzhou Strait from the mainland of China, The southern part of the island is mountainous, and has been the most malarias region of the island. Hainan Island is mainly rice farming, three quarters of a year, It’s favorable of Anopheles vectors breeding. As the main malaria vector in Hainan Island, Anopheles minimums have been controlled well by insecticide used more than a decade, the population of Anopheles minimums almost facing extinction. However, the other important malaria vectors populations have been reported more and more, just as Anopheles sinensis, Anopheles tessellatus and Anopheles vagus, et al. To completely eliminate Hainan Island malaria vector, our study the population surveillance, current status and mechanisms of insecticide resistance of the malaria vector Anopheles mosquito in Hainan Island as follow:Methods1. Investigation the main malaria vector population surveillance and insecticides were used in Hainan Island.In July and August2012, based on the different topography and elevation, we investigated12sites in Hainan Island. Finally, sampled enough malaria vector Anopheles number to study from Lingao, Linshui, Wenchang, Chengmai, Dinan, Tunchang, Baoting and Sanya8sites, Only larval own enough number to study larval population density. There are main three Anopheles type:Anopheles sinensis, Anopheles tessellatus and Anopheles vagus. We sampled Anopheles larva by350ml spoon to gain. Usually, we choose5points in one site and take average larvae of total5points to calculate larva population density. Each point use sized-spoon gain larva once a time. ALL larvae sampled from rice field. Adult mosquitoes sampled from cattle and pigsty by definite mosquito-sucker, and use the sampled adult numbers in unite time divided unite time, then take the average as adult population density For the reason cannot sampled enough adult number, we decided use larva population density as local mosquito population density. We accord the Anopheles different appearance to object and using PCR amply mosquito ITS2and D3region to assay Anopheles type. Always larval cannot be decided type, so we identification their type after they were incubated adult. At the same time, we also investigated each country used insecticide current in Hainan Island.2. Bioassay tests the main malaria vector in Hainan Island.Bioassay tests play an important role in study mechanisms of insecticide resistance of the malaria vector mosquito Anopheles, which can tell from the mosquito resistance or sensitivity to insecticide. According to WHO, we used the standard tube with sensitive layer contact adult method to test mosquito bioassay. Bioassay with0.05%Deltamethrin,4.0%DDT and5%Malathion impregnated papers, and we also made control papers (they all made in China CDC). Test mosquitoes were acquired form we collected larvae and pupae from Hainan Island8sites rearing in door and three days after emergence without fed blood.20mosquitoes once a time and total5times a site to satisfied statistical significance. At the same time, we put another20mosquitoes into control insecticide paper tested tube in each site, the mortality data of the control groups only to test the effection of the test paper. Procedure reference the "mosquito resistance bioassay method (GB/T26347-2010)" published by the China Standard Press. we put the test paper on the inner wall of the cylinder liner, as the contact tube, each time suck20female mosquitoes without fed blood in close contact cylinder clapboard, and we also suck20female mosquitoes without fed blood in close contact cylinder clapboard in the control tuber with each insecticide control paper. The numbers of knockdown and dead mosquitoes were recorded after10,15,20,30,40,50and60minutes of exposure. After1h exposure to insecticide impregnated papers, the surviving mosquitoes were blown recovery cylinder, with8%glucose water on the inside to rear,24h after recording tested mosquitoes mortality, all mosquitoes were immediately collected in EP tube single and preserved at-20℃. We sign the mosquito number based on the mosquito death time, marked one by one.3. Analysis metabolic detoxification enzyme activity of the main malaria vector in Hainan Island.3.1Mosquito enzyme with KPO4makeTake legs and head from each mosquito, signed and preserved at filled with200μL alcoholic0.5ml EP tuber, marked as before,-20℃. The other individuals were homogenized in a1.5-ml tube with300μL of phosphate KPO4buffer (0.25M, pH7.2) and using a connect the grinder (Argos, UK) grinding rod to grind the residue of the mosquito enough at4℃, the tube was mixed and centrifuged at1,3000rpm for5min, and the supernatant was removed to2.0EP tube and diluted by adding1,200ml of phosphate buffer, witch was used to test the activity of GST, P450and COE metabolic enzyme activity assays and total protein assay. Residues add200μL alcoholic were marked as before,-20℃preserved.3.2Total protein assayTwo replicates of40μL of each mosquito homogenate were placed in a disposable colorimetric cup (d=1), using0.25M KPO4buffer40μL as negative control, add900μL Coomassie protein assay reagent was mixed enough. The colorimetric cup was incubated for5min and read at595nm using biophotometer plus. Take two times average and CK, According bovine serum albumin was used to prepare a typical standard curve Y=28.977X2-22.201X+5.1657to calculate protein,(X:OD, Y:Bovine serum albumin protein), which subdue CK then times1500, divide40, and divide1000, to get the total protein (Unite:mg). We can use the total protein to calculate three assay activities.3.3Glutathione-S-transferase (GST) activityA total of200μL reduced glutathione solution and200μL cDNB solution, added200μL of mosquito homogenate (Glutathione solution:cDNB solution:mosquito homogenate=1:1:1) were mixed enough in a disposable colorimetric cup (d=1). Using0.25M KPO4buffer as the negative control, then every minute for4minutes at340nm, repeated again. The four times reading OD marked1,2,3,4, as4-1,4-2,4-3,3-1,3-2,2-1divide each reading inter time to get6number, take average subduce the average of CK divide time which result is one time operation, take two times operation result to make average, then times20as the final GST activity (Unite:μmol cDNB/min/mg protein).Total test956samples GST assay activities.3.4Cytochrome P450(Cyt P450) monooxygenases activityA total of8μL of the7-ethoxycoumarine (7-EC)(Sigma, E1379-25MG) solution was added to400μL of mosquito supernatant and samples were incubated at30℃for4h in a disposable colorimetric cup (d=1). Using0.25M KPO4buffer as the negative control, the reaction was stopped by the addition of560μL glycine buffer (pH10.4,0.1mM) and sample absorbance was read at450nm two times, repeated again. Take average of two times reading OD divided interval time once a time, then get two times operation average subdue CK, according to a standard regression based on a serial dilution of 7-hydroxycoumarin and its relevant OD values Y=88.47OD+4.88calculate final P450activity (Unite:7-HC/min/mg protein). Total test938samples P450assay activities.3.5Carboxylesterase (COE) activity assayA total of900μL p-nitrophenyl acetate solution to1.5ml EP tube and place the tube for5min in a30℃water bath, add100μL mosquito homogenates and then centrifuged at1,3000rpm for5min. Transfer the reaction mixture to a disposable colorimetric cup (d=1), read at405nm two times, using0.25M KPO4buffer as negative control, repeat again. Take the two times reading OD subdue the first times reading OD once a time, get the average two times subdue CK as final OD, according to the formula OD/(16.4X0.05Xprotein(mg/ml))X1000to calculate COE activity (Unites:nmol/min/mg protein). Total test903samples COE assay activities.4. Analysis target resistance of the main malaria vector in Hainan Island.For the reason DDT and pyrethroid insecticides target is the para-type sodium channel (SC), the target of organophosphate and carbamate insecticides is acetylcholinesterase (AChE). We did Knockdown resistance test before, and did ace-1test behind. One leg of each mosquito was used for DNA extraction with the E.Z.N. A. TM Micro Elute Genomic DNA Kit (Operate as Product).4.1PCR amply the target of the Knockdown resistance L1014site testPara sodium channels with rapid knockdown effect of insecticide resistance, this is called knockdown resistance (Knock down resisters, Kdr). Anopheles sodium channel second functional areas in the hydrophobic region of S6, leucine to phenylalanine mutation at codon1014. Usually leucine was replaced by phenylalanine (LeuyPhe) or serine or cysteine mutation at codon1014, and in turn was named L1014F, L1014S and L1014C. So we test the codon1014. PCR primers5’→3’of An. sinensis are Kdr-F1023(TGCCACTCCGTGTGTTTAGA)and Kdr-R1347(GAGCGATGATGATCCGAAAT), the cycling conditions of An. sinensis was as follows:initial denaturation at94℃for3min,45cycles of lmin denaturation at94℃,30s annealing at50℃and30s extension at72℃followed by a final extension of10min at72℃. We amplified a325bp fragment product and sequenced. PCR primers5’→3’of An. vagus are Agd1mi-F (TAGGTCACGGTGAGTCCGYA) and Agd2h-R (ACCACGATCACGTTCTCCTC), The cycling conditions of An. vagus was only change the temperate of annealing from50℃to47℃, others are same as An. sinensis. 4.2PCR-RFLP amplify the target of Ace-1gene at positions119testUse PCR-RFLP amplify test to determine point mutations of Anopheles sinensis and Anopheles Vagus the ace-1gene at positions119. The PCR primes are Ace-1-F22F and Ace-1-R660. The cycling conditions were as follows:initial denaturation at94℃for3min,35cycles of45s denaturation at94℃,30s annealing at55℃and30s extension at72℃followed by a final extension of5min at72℃.2.5%agarose gel electrophoresis test the product, we get602bp product of Anopheles sinensis, and571bp product of Anopheles Vagus. Then we use the restriction end nuclease AIU1of PCR products were digested by enzyme (Operate as Product). Homozygous mutations type was amplified two bands (118bp and75bp), Wild type was only amplified one band (193bp), Heterozygous mutations type was amplified three bands (193bp,118bp and75bp), and the gene type simply:wild type is GGC/GGC, heterozygous mutations type is GGC/AGC and homozygous mutations type is AGC/AGC. We accorded mutation number to calculate frequency of G119mutation.5. Statistical analysisAll data were statistical analyzed by SPSS13.0software. Mosquito mortality rates after the24hr recovery period were calculated for each insecticide and each population. Mosquito contact no pesticides but blank film corresponding solvent as control correction. Each repeated corrected mortality to calculate the average mortality and standand devation of each mosquito population after each insecticide treatment. Each population handling pesticides each within24hours after the death of the mosquito is divided into sensitive mosquitoes (sensitive group S),24hours after the live mosquitoes into resistant mosquitoes (resistance group R).Chi-square tests or Fisher exact probability tests were used to examine the association between target site mutations and the resistance phenotype. Two independent samples t test was used to compare the enzyme activities between resistant and susceptible mosquitoes for each population. When P<0.05had statistical significance. At the same time is calculated for each of the mosquito population resistance to insecticide treatment group for each site and sensitive group of mosquito enzyme activity ratio (R/S ratio), calculated using the following formula between resistant and susceptible Ratio Standards:SD=SQRT [(SDR/MR)2+(SDs/Ms)2].Results 1. Result of Investigation the main malaria vector population surveillance and insecticides were used in Hainan Island.8sites of Hainan Island we found that Anopheles sinensis are main distribute at Sanya (0.923±0.280number/spoon) and Baoting (1.056±0.665number/spoon), Anopheles tessellatus are main distribute at Sanya (1.979±1.470number/spoon), Baoting (4.572±1.855number/spoon) and linshui (1.143±0.595number/spoon), Anopheles vagus are main distribute at the Northeast in Hainan Island, including Chengmai (1.363±0.980number/spoon), Lingao (1.012±0.595number/spoon), Dingan (1.275±0.175number/spoon), Tunchang (1.099±0.420number/spoon) and Wenchang (4.792±1.085number/spoon). Pyrethroids insecticide were used in8sites we sampled, just as Deltamethrin, Methothrin, Beta cypermethrin, Bifenthrin, Lambda-cyhalothrin, et al. Organophosphates insecticide just as Imidacloprid were used in Baoting, Lingao, Tunchang. Organochlorines insecticide just as DDT was forbidden used in China, but we surprised found they were used in Baoting, Dinan, Wenchang. Imidacloprid were found used in Sanya, Baoting, Chengmai, Wenchang.2. Result of bioassay tests the main malaria vector in Hainan Island.For the reason we cannot get enough adult number and each site use different insecticide in Hainan Island, we did bioassay use different insecticide paper to different sites. ALL control groups mortality is zero. Total tested1725samples and result of each site each insecticide as follow:2.1Result of0.05%Deltamethrin bioassayAnopheles sinensis have initial0.05%Deltamethrin resistance in Sanya (85.78%±17.54%) and Baoting (90.98%±9.39%). Anopheles vagus has0.05%Deltamethrin resistant in Chenmai (97.87%±4.31%) and Dinan (100%). Anopheles tessellates have0.05%Deltamethrin resistant, the mosquito mortality is100%in Sanya and Lingshui.2.2Result of4%DDT bioassayAnopheles sinensis have4%DDT resistant in Sanya (78.38%±15.83%) and Baoting (72.71%±21.20%). Anopheles vagus have4%DDT resistant in Tunchang (67.057%±7.54%) and have initial4%DDT resistance in Chengmai (84.00%±11.68%) and Dinan (88.82%±10.07%).2.3Result of5%Malathion bioassayAnopheles vagus has5%Malathion initial resistance in Dinan (77.29%±10.57%), Chenmai (88.87%±4.26%) and Tunchang (78.86%±9.49%).3. Result of analysis metabolic detoxification enzyme activity of the main malaria vector in Hainan Island.3.1Result of Glutathione-S-transferase (GST) activityWe found the GST metabolic enzyme activities R/S ratio of Anopheles vagus was significantly higher in the two sites from Hainan Island (Dinan, Tunchang), where mosquitoes were tested bioassay by5%Malathion. The ratio of Dinan and Tunchang respectively was1.1361±0.3145(t=2.806, P=0.0060) and1.1141±0.1853(t=2.501, P=0.0150).(Unite:μmol cDNB/min/mg protein).3.2Result of Cytochrome P450(Cyt P450) monooxygenases activityWe found the P450metabolic enzyme activities R/S ratio of Anopheles sinensis was significantly higher in the two sites from Hainan Island, the ratio of Baoting and Sanya (used0.05%Deltamethrin to test bioassay) respectively was1.5278±0.6072(t=2.575,F=6.6300, P=0.0115) and1.5391±0.8130(t=2.738, P=0.0076), and the ratio of Baoting and Sanya (used4%DDT to test bioassay) respectively was1.2662±0.7366(t=2.145, P=0.0346) and1.2732±0.5853(t=2.317,P=0.0226). The P450metabolic enzyme activities R/S ratio of Anopheles vagus was significantly higher in the one site from Hainan Island (Dingan), where mosquitoes were tested bioassay by5%Malathion. The ratio was1.3143±0.7058(t=2.417, P=0.0175).(Unite:7-HC/min/mg protein).3.3Result of Carboxylesterase (COE) activity assayWe found the COE metabolic enzyme activities R/S ratio of Anopheles sinensis was significantly higher in the two sites from Hainan Island (Baoting, Sanya), where mosquitoes were tested bioassay by0.05%Deltamethrin. The ratio of Baoting and Sanya respectively was1.2738±0.4677(t=2.009, P=0.0470) and1.2580±0.3507(t=3.478, P=0.0010).(Unite:nmol/min/mg protein).4. Result of Analysis target resistance of the main malaria vector in Hainan Island.4.1Result of PCR amply the target of Knockdown resistance L1014site testThe kdr mutation of An. Sinensis only detected one heterozygous mutations type (TTG/TTT):Leucine to Phenylalanine substitution. The kdr mutation frequency of Deltamethrin-resistant mosquitoes from Sanya and DDT-resistant mosquitoes from Sanya and Baoting individuate is7.5%(P=0.025),9.5%(P=0.015) and7.8%(P=0.011),they are all L1014F mutation, which maybe related with An. sinensis insecticide resistance. No kdr mutations were detected in An. vagus populations from Hainan Island, China.4.2Result of PCR-RFLP amplified the target of Ace-1gene at positions119testModest to high (53%-72%) ace-1mutation frequency was found in all sites we sampled An. sinensis populations, the resistance group mutation frequency higher than the sensitive group. But no ace-1mutation was detected in An. vagus populations.Conclusions:1. During7-8months, the main malaria vectors were An. sinensis, An. vagus and An. tessellates in Hainan Island. An. sinensis and An. tessellates populations were main sampled in Southern of Hainan Island, An. vagus population were main found in Northest of Hainan Island. Pyrethroid mosquito coils insecticides were the most propular insecticide to spray in rice frield in Hainan.2. Result of Bioassay tests shows that Deltamethrin resistance was widespread over the Anopheles sinensis populations of Sanya and Baoting, DDT resistance was widespread over the Anopheles sinensis and Anopheles vagus populations, Malathion resistance was widespread over the Anopheles vagus populations of Chengmai, Dinan and Tunchang. Result of PCR-RFLP amplified the target of Ace-1gene at positions119test shows that Malathion resistance was widespread over the Anopheles sinensis populations of Sanya and Baoting.3. The Kdr and enzyme assay results show that metabolic detoxification mechanisms are wide-spread in An. Sinensis and An. vagus populations from Hainan Island China, the target site mutations(L1014F) was only detected in An. Sinensis suggest the mechanisms of An. vagus insecticide resistant from Hainan Island is not relations to Kdr, but consider maybe relation with the metabolic detoxification enzyme activity. Then the mechanisms of An. Sinensis insecticide resistant maybe the common function with Kdr and metabolic detoxification enzyme activity. It is therefore likely that the selection pressure occurred on the larval stages by insecticides used for agricultural purposes.
Keywords/Search Tags:Malaria vector, Mechanism of insecticide resistance, Bioassay, Metabolic detoxification enzyme, Knockdown resistance.
PDF Full Text Request
Related items